Incidental Mutation 'R8141:Rasal2'
ID632510
Institutional Source Beutler Lab
Gene Symbol Rasal2
Ensembl Gene ENSMUSG00000070565
Gene NameRAS protein activator like 2
SynonymsA330066M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location157135182-157412595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157164670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 569 (D569G)
Ref Sequence ENSEMBL: ENSMUSP00000077423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078308
AA Change: D569G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: D569G

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
PH 58 307 3.97e-8 SMART
C2 317 413 6.01e-10 SMART
RasGAP 423 767 4.56e-157 SMART
low complexity region 780 791 N/A INTRINSIC
low complexity region 1063 1075 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
coiled coil region 1117 1236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132699
AA Change: D551G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: D551G

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
PH 40 289 1.7e-10 SMART
C2 299 395 4e-12 SMART
RasGAP 405 742 4.2e-153 SMART
low complexity region 755 766 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1059 1067 N/A INTRINSIC
coiled coil region 1092 1211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Rasal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Rasal2 APN 1 157147817 missense probably benign
IGL00484:Rasal2 APN 1 157174175 splice site probably null
IGL00731:Rasal2 APN 1 157157764 missense probably benign 0.01
IGL00900:Rasal2 APN 1 157411929 missense possibly damaging 0.73
IGL01346:Rasal2 APN 1 157161216 missense probably benign 0.19
IGL01635:Rasal2 APN 1 157163824 missense probably damaging 1.00
IGL01759:Rasal2 APN 1 157175932 missense probably benign 0.42
IGL01939:Rasal2 APN 1 157175910 missense probably damaging 1.00
IGL01954:Rasal2 APN 1 157177699 missense possibly damaging 0.83
IGL01954:Rasal2 APN 1 157176116 missense probably damaging 0.99
IGL02005:Rasal2 APN 1 157156998 nonsense probably null
IGL02056:Rasal2 APN 1 157299261 missense probably damaging 0.99
IGL02444:Rasal2 APN 1 157299195 missense probably benign 0.20
IGL02496:Rasal2 APN 1 157149879 missense possibly damaging 0.69
IGL02832:Rasal2 APN 1 157157207 missense probably damaging 1.00
IGL03351:Rasal2 APN 1 157192741 splice site probably benign
R0456:Rasal2 UTSW 1 157149843 missense probably damaging 1.00
R0537:Rasal2 UTSW 1 157147792 missense possibly damaging 0.46
R0681:Rasal2 UTSW 1 157157180 missense possibly damaging 0.70
R0682:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0683:Rasal2 UTSW 1 157179209 missense probably damaging 1.00
R0787:Rasal2 UTSW 1 157158696 missense probably damaging 1.00
R0789:Rasal2 UTSW 1 157157321 missense probably damaging 1.00
R1109:Rasal2 UTSW 1 157177638 unclassified probably benign
R1175:Rasal2 UTSW 1 157147648 missense probably damaging 1.00
R1332:Rasal2 UTSW 1 157175821 missense probably benign 0.00
R1396:Rasal2 UTSW 1 157164666 missense probably damaging 1.00
R1535:Rasal2 UTSW 1 157230059 missense probably benign 0.28
R1542:Rasal2 UTSW 1 157175851 missense possibly damaging 0.84
R1703:Rasal2 UTSW 1 157157600 missense probably damaging 1.00
R1735:Rasal2 UTSW 1 157174160 missense probably damaging 1.00
R1762:Rasal2 UTSW 1 157299144 missense possibly damaging 0.52
R2570:Rasal2 UTSW 1 157161300 missense possibly damaging 0.85
R3148:Rasal2 UTSW 1 157243764 intron probably benign
R3157:Rasal2 UTSW 1 157158655 splice site probably benign
R4277:Rasal2 UTSW 1 157157126 missense possibly damaging 0.46
R4459:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4460:Rasal2 UTSW 1 157175832 missense possibly damaging 0.46
R4563:Rasal2 UTSW 1 157175991 missense probably damaging 1.00
R4672:Rasal2 UTSW 1 157243661 missense probably benign 0.10
R4894:Rasal2 UTSW 1 157192804 missense probably damaging 0.97
R5147:Rasal2 UTSW 1 157175694 missense probably damaging 1.00
R5387:Rasal2 UTSW 1 157157765 missense possibly damaging 0.81
R5421:Rasal2 UTSW 1 157299141 missense probably benign 0.37
R5459:Rasal2 UTSW 1 157157661 missense probably damaging 0.99
R5651:Rasal2 UTSW 1 157157381 missense probably damaging 1.00
R5767:Rasal2 UTSW 1 157176162 missense probably damaging 1.00
R5778:Rasal2 UTSW 1 157161290 missense probably damaging 1.00
R6298:Rasal2 UTSW 1 157411862 missense possibly damaging 0.85
R6332:Rasal2 UTSW 1 157299187 missense probably damaging 1.00
R6571:Rasal2 UTSW 1 157161179 missense possibly damaging 0.72
R7258:Rasal2 UTSW 1 157157700 missense probably damaging 0.96
R7545:Rasal2 UTSW 1 157192769 missense possibly damaging 0.93
R7558:Rasal2 UTSW 1 157175836 missense probably damaging 0.99
R7894:Rasal2 UTSW 1 157243648 missense probably benign 0.01
R8140:Rasal2 UTSW 1 157299235 missense probably damaging 0.97
R8151:Rasal2 UTSW 1 157243584 missense probably damaging 0.96
R8218:Rasal2 UTSW 1 157157381 missense probably damaging 0.99
R8517:Rasal2 UTSW 1 157146279 critical splice acceptor site probably null
RF024:Rasal2 UTSW 1 157147790 missense probably damaging 0.97
Z1177:Rasal2 UTSW 1 157175673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTTAGAGTGAAGGGTG -3'
(R):5'- CAGTACATGGGTGGAGTTAGC -3'

Sequencing Primer
(F):5'- CTTAGAGTGAAGGGTGACATTTAAAC -3'
(R):5'- AGTTAGCTGTTAGGTTCTAAAGCAG -3'
Posted On2020-06-30