Incidental Mutation 'R8141:Olfr430'
ID632512
Institutional Source Beutler Lab
Gene Symbol Olfr430
Ensembl Gene ENSMUSG00000050134
Gene Nameolfactory receptor 430
SynonymsGA_x6K02T2P20D-21108443-21107490, MOR105-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174066605-174072273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174069922 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 208 (L208P)
Ref Sequence ENSEMBL: ENSMUSP00000150451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055873] [ENSMUST00000213425] [ENSMUST00000214390]
Predicted Effect probably damaging
Transcript: ENSMUST00000055873
AA Change: L208P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130615
Gene: ENSMUSG00000050134
AA Change: L208P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-65 PFAM
Pfam:7tm_1 41 290 9.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213425
AA Change: L208P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214390
AA Change: L208P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Olfr430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr430 APN 1 174070066 missense probably benign 0.00
IGL02279:Olfr430 APN 1 174069391 missense probably null 1.00
IGL02537:Olfr430 APN 1 174069454 missense possibly damaging 0.63
R0323:Olfr430 UTSW 1 174069327 missense probably benign
R0627:Olfr430 UTSW 1 174070077 missense probably damaging 1.00
R1079:Olfr430 UTSW 1 174069466 missense possibly damaging 0.95
R1757:Olfr430 UTSW 1 174069658 missense probably damaging 1.00
R1902:Olfr430 UTSW 1 174070126 missense probably damaging 0.96
R3804:Olfr430 UTSW 1 174069908 missense probably damaging 1.00
R3927:Olfr430 UTSW 1 174069312 missense probably damaging 1.00
R3930:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R3931:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R4111:Olfr430 UTSW 1 174069433 missense probably damaging 1.00
R4210:Olfr430 UTSW 1 174070008 missense probably damaging 0.98
R4383:Olfr430 UTSW 1 174069477 missense probably benign 0.34
R4651:Olfr430 UTSW 1 174069828 missense possibly damaging 0.54
R5097:Olfr430 UTSW 1 174069529 missense probably benign 0.22
R5385:Olfr430 UTSW 1 174069470 missense probably benign 0.31
R5722:Olfr430 UTSW 1 174069870 missense probably damaging 1.00
R6608:Olfr430 UTSW 1 174069729 missense probably benign 0.00
R6643:Olfr430 UTSW 1 174070045 missense probably damaging 1.00
R7316:Olfr430 UTSW 1 174070161 missense probably benign 0.00
R7532:Olfr430 UTSW 1 174070098 missense probably benign 0.37
Z1088:Olfr430 UTSW 1 174069949 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069331 missense probably damaging 1.00
Z1176:Olfr430 UTSW 1 174069514 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAAAGATGGCTGCTGGCTG -3'
(R):5'- CTAGAGTGCGGTCAAGAGTC -3'

Sequencing Primer
(F):5'- CTGCTGGCTGCTGGACTTG -3'
(R):5'- GGTCAAGAGTCAATGAGTAGCTCTTC -3'
Posted On2020-06-30