Incidental Mutation 'R8141:Ccm2l'
ID632519
Institutional Source Beutler Lab
Gene Symbol Ccm2l
Ensembl Gene ENSMUSG00000027474
Gene Namecerebral cavernous malformation 2-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8141 (G1)
Quality Score158.009
Status Validated
Chromosome2
Chromosomal Location153065955-153081735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153070871 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 110 (L110P)
Ref Sequence ENSEMBL: ENSMUSP00000122732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109800] [ENSMUST00000129377]
Predicted Effect probably damaging
Transcript: ENSMUST00000109800
AA Change: L111P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105425
Gene: ENSMUSG00000027474
AA Change: L111P

DomainStartEndE-ValueType
Blast:PTB 60 160 9e-16 BLAST
low complexity region 163 184 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
internal_repeat_1 236 251 1.67e-6 PROSPERO
low complexity region 252 261 N/A INTRINSIC
internal_repeat_1 262 280 1.67e-6 PROSPERO
low complexity region 372 389 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129377
AA Change: L110P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122732
Gene: ENSMUSG00000027474
AA Change: L110P

DomainStartEndE-ValueType
Blast:PTB 60 136 7e-9 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit delayed wound healing and show impaired tumor growth, poor tumor vascularization, and decreased metastatic potential following injection of Lewis Lung Carcinoma (LLC) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Ccm2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Ccm2l APN 2 153080901 splice site probably benign
IGL01826:Ccm2l APN 2 153067933 splice site probably benign
IGL02821:Ccm2l APN 2 153067859 missense probably damaging 1.00
IGL02961:Ccm2l APN 2 153078601 missense probably benign 0.03
IGL03237:Ccm2l APN 2 153066002 utr 5 prime probably benign
R0103:Ccm2l UTSW 2 153067919 nonsense probably null
R0103:Ccm2l UTSW 2 153067919 nonsense probably null
R0420:Ccm2l UTSW 2 153070862 missense probably null 0.08
R0617:Ccm2l UTSW 2 153070900 missense probably damaging 0.99
R0760:Ccm2l UTSW 2 153072184 missense probably damaging 0.99
R1309:Ccm2l UTSW 2 153070924 missense probably damaging 0.97
R4787:Ccm2l UTSW 2 153079502 missense probably benign 0.00
R7106:Ccm2l UTSW 2 153070651 missense possibly damaging 0.45
R7159:Ccm2l UTSW 2 153070867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAGAATCTCCCATTTCTC -3'
(R):5'- AAATGTCCCAGCACTGCAGG -3'

Sequencing Primer
(F):5'- AGTTCCTGGGTCACCTCAC -3'
(R):5'- AGCACTGCAGGTTGGCTTC -3'
Posted On2020-06-30