Incidental Mutation 'R8141:Usp13'
ID632520
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Nameubiquitin specific peptidase 13 (isopeptidase T-3)
SynonymsISOT3, 2700071E21Rik, IsoT-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32817546-32938071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32894876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 454 (V454A)
Ref Sequence ENSEMBL: ENSMUSP00000072155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072312
AA Change: V454A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900
AA Change: V454A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108228
AA Change: V453A

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900
AA Change: V453A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172481
AA Change: V454A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900
AA Change: V454A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32881411 missense probably damaging 0.98
IGL00949:Usp13 APN 3 32886577 missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32919064 missense probably benign 0.02
IGL01983:Usp13 APN 3 32917459 missense probably damaging 1.00
IGL02002:Usp13 APN 3 32847825 missense probably damaging 0.97
IGL02065:Usp13 APN 3 32933165 missense probably damaging 1.00
IGL02390:Usp13 APN 3 32931716 nonsense probably null
IGL02399:Usp13 APN 3 32919060 missense probably damaging 1.00
IGL02535:Usp13 APN 3 32837926 missense probably benign 0.43
IGL02863:Usp13 APN 3 32918947 missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32915712 missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32902069 missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32905430 missense probably damaging 1.00
R0113:Usp13 UTSW 3 32817876 splice site probably benign
R0233:Usp13 UTSW 3 32915664 splice site probably null
R0233:Usp13 UTSW 3 32915664 splice site probably null
R1241:Usp13 UTSW 3 32915708 missense probably damaging 1.00
R1765:Usp13 UTSW 3 32915770 missense probably benign 0.01
R2105:Usp13 UTSW 3 32901986 missense probably damaging 0.97
R2229:Usp13 UTSW 3 32917551 missense probably benign 0.02
R2381:Usp13 UTSW 3 32881509 critical splice donor site probably null
R2389:Usp13 UTSW 3 32905464 missense probably benign 0.16
R3801:Usp13 UTSW 3 32881508 missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32881423 missense probably damaging 1.00
R4653:Usp13 UTSW 3 32837924 missense probably damaging 0.99
R5123:Usp13 UTSW 3 32915798 missense probably benign 0.03
R5454:Usp13 UTSW 3 32905436 missense probably damaging 1.00
R5527:Usp13 UTSW 3 32865838 missense probably damaging 1.00
R5582:Usp13 UTSW 3 32911589 missense probably damaging 1.00
R5589:Usp13 UTSW 3 32837858 missense probably damaging 1.00
R5829:Usp13 UTSW 3 32886523 missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32854669 missense probably damaging 1.00
R6625:Usp13 UTSW 3 32894876 missense probably damaging 0.98
R6680:Usp13 UTSW 3 32881469 missense probably damaging 0.98
R7175:Usp13 UTSW 3 32917608 nonsense probably null
R7232:Usp13 UTSW 3 32865871 missense probably benign 0.05
R7242:Usp13 UTSW 3 32865743 splice site probably null
R7263:Usp13 UTSW 3 32894851 missense probably damaging 1.00
R7533:Usp13 UTSW 3 32918942 missense probably damaging 0.99
R7716:Usp13 UTSW 3 32837856 nonsense probably null
R7734:Usp13 UTSW 3 32837905 missense probably benign 0.13
R7943:Usp13 UTSW 3 32876940 missense probably damaging 1.00
R8075:Usp13 UTSW 3 32931703 missense probably damaging 1.00
R8259:Usp13 UTSW 3 32917599 nonsense probably null
X0064:Usp13 UTSW 3 32886589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGTATGTCACCAGGAGTC -3'
(R):5'- TGGAACCCAAATTTGAGAGGCTG -3'

Sequencing Primer
(F):5'- GCTATGTCTCCTTAGCAGAATGACAG -3'
(R):5'- GCTGTCACATCGAGTATGCATAGC -3'
Posted On2020-06-30