Mutagenetix > Incidental Mutation

Incidental Mutation 'R8141:Kirrel1'

632523

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

MMRRC Submission

067569-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8141 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 86993735 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 507 (W507*)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: W507*

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: W507*

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: W507*

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: W507*

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: W507*

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: W507*

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.3%
20x: 90.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,165,688 (GRCm39)	T229A	probably benign	Het
4930438A08Rik	A	G	11: 58,177,411 (GRCm39)	E40G		Het
Actn2	T	C	13: 12,303,516 (GRCm39)	D428G	probably damaging	Het
Arl14epl	C	A	18: 47,059,410 (GRCm39)	N8K	probably benign	Het
Bend7	T	C	2: 4,757,636 (GRCm39)	V226A	probably benign	Het
C1s1	A	T	6: 124,508,321 (GRCm39)	L556Q	probably damaging	Het
Casr	T	C	16: 36,315,173 (GRCm39)	K966E	probably damaging	Het
Ccm2l	T	C	2: 152,912,791 (GRCm39)	L110P	probably damaging	Het
Cdhr4	G	A	9: 107,873,991 (GRCm39)	R59H		Het
Celf3	C	A	3: 94,395,850 (GRCm39)	N410K	probably damaging	Het
Cfap251	T	G	5: 123,424,493 (GRCm39)	V726G	possibly damaging	Het
Cpne6	T	C	14: 55,750,066 (GRCm39)	C66R	possibly damaging	Het
Cyp2f2	G	A	7: 26,828,678 (GRCm39)	V183I	probably benign	Het
Eln	CTCCAGCTCCGAT	C	5: 134,758,003 (GRCm39)		probably benign	Het
Fam53b	A	C	7: 132,361,758 (GRCm39)	V90G	probably damaging	Het
Fat3	T	A	9: 15,908,362 (GRCm39)	I2547F	possibly damaging	Het
Foxk1	A	G	5: 142,439,716 (GRCm39)	Y524C	probably damaging	Het
Gpr87	A	G	3: 59,087,020 (GRCm39)	S162P	probably damaging	Het
Ifi204	A	G	1: 173,583,189 (GRCm39)	V343A	possibly damaging	Het
Igsf10	A	G	3: 59,237,949 (GRCm39)	L744P	probably damaging	Het
Iqub	T	A	6: 24,491,608 (GRCm39)	K359N	probably benign	Het
Kdm3b	A	T	18: 34,961,599 (GRCm39)	K1459*	probably null	Het
Klra17	T	C	6: 129,849,292 (GRCm39)	D94G	probably damaging	Het
Llgl1	G	C	11: 60,601,142 (GRCm39)	E693D	probably benign	Het
Lrrc37	T	C	11: 103,511,855 (GRCm39)	T38A	unknown	Het
Lypd4	A	T	7: 24,564,254 (GRCm39)	D201E	possibly damaging	Het
Nin	A	G	12: 70,076,795 (GRCm39)	S1794P		Het
Oog2	T	C	4: 143,920,777 (GRCm39)	L70P	probably damaging	Het
Or6n2	T	C	1: 173,897,488 (GRCm39)	L208P	probably damaging	Het
Pacsin1	G	T	17: 27,926,034 (GRCm39)	R282S	possibly damaging	Het
Pcdhb9	T	A	18: 37,535,361 (GRCm39)	Y452N	probably damaging	Het
Pdgfra	T	C	5: 75,338,387 (GRCm39)	V547A	possibly damaging	Het
Plcb4	T	C	2: 135,781,169 (GRCm39)	F209L	probably damaging	Het
Pnpla6	T	C	8: 3,571,384 (GRCm39)	S158P	probably benign	Het
Prlhr	C	G	19: 60,455,747 (GRCm39)	R273P	probably damaging	Het
Prss41	G	A	17: 24,056,607 (GRCm39)	P196L	probably damaging	Het
Ptgr3	T	C	18: 84,112,651 (GRCm39)	L109P	probably benign	Het
Ptpn22	A	G	3: 103,793,643 (GRCm39)	E598G	possibly damaging	Het
Rasal2	T	C	1: 156,992,240 (GRCm39)	D569G	possibly damaging	Het
Sf3b3	A	C	8: 111,547,483 (GRCm39)	M715R	possibly damaging	Het
Ska1	T	C	18: 74,339,907 (GRCm39)	N13S	probably benign	Het
Spocd1	A	C	4: 129,823,497 (GRCm39)	E98A		Het
Sycp1	G	T	3: 102,842,885 (GRCm39)	A28E	possibly damaging	Het
Syf2	C	T	4: 134,664,182 (GRCm39)	R199C	probably damaging	Het
Syne2	A	G	12: 76,108,442 (GRCm39)	D942G	possibly damaging	Het
Tamalin	T	A	15: 101,129,790 (GRCm39)	C358S	possibly damaging	Het
Tmem63a	A	G	1: 180,801,776 (GRCm39)	T764A	probably benign	Het
Ttf1	C	T	2: 28,957,238 (GRCm39)	Q503*	probably null	Het
Usp13	T	C	3: 32,949,025 (GRCm39)	V454A	possibly damaging	Het
Usp47	A	G	7: 111,652,472 (GRCm39)	T50A	possibly damaging	Het
Zfyve26	A	T	12: 79,315,331 (GRCm39)	C1382S	possibly damaging	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCTACAACTGTTCCTTCAAAG -3'
(R):5'- ATGAGCTTCTTCCACGCATC -3'

Sequencing Primer
(F):5'- ACTGTTCCTTCAAAGTTCAACAC -3'
(R):5'- GAGCTTCTTCCACGCATCCTTTTC -3'

Posted On

2020-06-30