Incidental Mutation 'R8141:Ptpn22'
ID632526
Institutional Source Beutler Lab
Gene Symbol Ptpn22
Ensembl Gene ENSMUSG00000027843
Gene Nameprotein tyrosine phosphatase, non-receptor type 22 (lymphoid)
Synonyms70zpep, Ptpn8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R8141 (G1)
Quality Score218.009
Status Validated
Chromosome3
Chromosomal Location103859795-103912247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103886327 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 598 (E598G)
Ref Sequence ENSEMBL: ENSMUSP00000029433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029433] [ENSMUST00000146071]
PDB Structure
Solution structure of the SH3 domain from C-terminal Src Kinase complexed with a peptide from the tyrosine phosphatase PEP [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029433
AA Change: E598G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029433
Gene: ENSMUSG00000027843
AA Change: E598G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 2e-65 BLAST
PDB:1JEG|B 605 629 2e-8 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000146071
AA Change: E598G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122307
Gene: ENSMUSG00000027843
AA Change: E598G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
PTPc 23 291 3.32e-123 SMART
Blast:PTPc 305 502 9e-66 BLAST
internal_repeat_1 567 629 1.92e-7 PROSPERO
internal_repeat_1 651 705 1.92e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes of member of the non-receptor class 4 subfamily of the protein-tyrosine phosphatase family. The encoded protein is a lymphoid-specific intracellular phosphatase that associates with the molecular adapter protein CBL and may be involved in regulating CBL function in the T-cell receptor signaling pathway. Mutations in this gene may be associated with a range of autoimmune disorders including Type 1 Diabetes, rheumatoid arthritis, systemic lupus erythematosus and Graves' disease. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice display antigen dependent increases in T cell proliferation and cytokine production, enlarged spleens and lymph nodes, increased spontaneous germinal center formation, increased B cell numbers, and increased serum IgG and IgE levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Ptpn22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Ptpn22 APN 3 103903374 missense probably benign 0.01
IGL01373:Ptpn22 APN 3 103886204 missense probably damaging 0.99
IGL01943:Ptpn22 APN 3 103886336 missense probably benign 0.02
IGL02092:Ptpn22 APN 3 103877321 missense probably damaging 1.00
IGL02431:Ptpn22 APN 3 103903397 missense probably benign 0.01
IGL02732:Ptpn22 APN 3 103886033 missense probably damaging 0.98
IGL02738:Ptpn22 APN 3 103874066 splice site probably benign
IGL03406:Ptpn22 APN 3 103912016 missense probably benign 0.14
R0490:Ptpn22 UTSW 3 103886179 missense probably damaging 1.00
R0494:Ptpn22 UTSW 3 103860455 missense probably damaging 1.00
R0626:Ptpn22 UTSW 3 103860405 start codon destroyed probably null 1.00
R0743:Ptpn22 UTSW 3 103902171 missense probably damaging 1.00
R1441:Ptpn22 UTSW 3 103874247 missense probably damaging 1.00
R1610:Ptpn22 UTSW 3 103902196 splice site probably null
R1698:Ptpn22 UTSW 3 103885798 missense probably benign 0.20
R1785:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1786:Ptpn22 UTSW 3 103874052 missense probably damaging 0.99
R1919:Ptpn22 UTSW 3 103876738 critical splice donor site probably null
R2045:Ptpn22 UTSW 3 103874021 missense possibly damaging 0.61
R3977:Ptpn22 UTSW 3 103873641 splice site probably benign
R4176:Ptpn22 UTSW 3 103886245 missense probably benign 0.00
R4478:Ptpn22 UTSW 3 103902064 intron probably benign
R5093:Ptpn22 UTSW 3 103882102 missense probably benign 0.39
R5579:Ptpn22 UTSW 3 103882139 splice site probably null
R6022:Ptpn22 UTSW 3 103886105 missense probably benign 0.00
R6110:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R6387:Ptpn22 UTSW 3 103885386 missense probably benign 0.18
R7335:Ptpn22 UTSW 3 103886019 missense probably damaging 0.97
R7516:Ptpn22 UTSW 3 103885538 missense probably benign 0.16
R7523:Ptpn22 UTSW 3 103912015 missense probably damaging 0.96
R7583:Ptpn22 UTSW 3 103902114 missense probably benign 0.11
R8129:Ptpn22 UTSW 3 103890284 critical splice donor site probably null
Z1177:Ptpn22 UTSW 3 103885700 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GAATAGTGCTGATTCGAAGATGTC -3'
(R):5'- TATGAGGCCTTCCTGTTGGC -3'

Sequencing Primer
(F):5'- GTCTTTTGATCTGCCTGAGAAACAG -3'
(R):5'- TGTTGGCACAGATGGGTCCC -3'
Posted On2020-06-30