Incidental Mutation 'R8141:Syf2'
ID632528
Institutional Source Beutler Lab
Gene Symbol Syf2
Ensembl Gene ENSMUSG00000028821
Gene NameSYF2 homolog, RNA splicing factor (S. cerevisiae)
Synonymsmp29, 1110018L13Rik, Gcipip, p29, D4Bwg1551e, Cbpin, Ntc31
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134930898-134937548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134936871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 199 (R199C)
Ref Sequence ENSEMBL: ENSMUSP00000030622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030622]
Predicted Effect probably damaging
Transcript: ENSMUST00000030622
AA Change: R199C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030622
Gene: ENSMUSG00000028821
AA Change: R199C

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Pfam:SYF2 89 237 9.8e-60 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele fail to undergo normal gastrulation and exhibit complete embryonic lethality, severely impaired embryonic development, and abnormal cell cycle checkpoint function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Syf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Syf2 APN 4 134935052 splice site probably null
R0839:Syf2 UTSW 4 134936063 missense probably damaging 0.97
R1475:Syf2 UTSW 4 134935434 missense possibly damaging 0.52
R4673:Syf2 UTSW 4 134934493 missense probably damaging 1.00
R4954:Syf2 UTSW 4 134934972 nonsense probably null
R5309:Syf2 UTSW 4 134936069 missense probably benign 0.35
R6256:Syf2 UTSW 4 134934578 missense probably damaging 0.98
R8334:Syf2 UTSW 4 134931275 missense probably benign 0.16
Z1176:Syf2 UTSW 4 134936964 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATCAGAGAAGGCAGTTCAGACC -3'
(R):5'- CCACGAGGGAGGTTGAATTTG -3'

Sequencing Primer
(F):5'- CCAGAAGGTGGTTGAACGCC -3'
(R):5'- TTGAATTTGCCAGCAGAAGCCTC -3'
Posted On2020-06-30