Incidental Mutation 'R8141:Cyp2f2'
ID632538
Institutional Source Beutler Lab
Gene Symbol Cyp2f2
Ensembl Gene ENSMUSG00000052974
Gene Namecytochrome P450, family 2, subfamily f, polypeptide 2
SynonymsCyp2f
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R8141 (G1)
Quality Score119.008
Status Validated
Chromosome7
Chromosomal Location27119909-27133660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27129253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 183 (V183I)
Ref Sequence ENSEMBL: ENSMUSP00000003100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003100] [ENSMUST00000206552]
Predicted Effect probably benign
Transcript: ENSMUST00000003100
AA Change: V183I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003100
Gene: ENSMUSG00000052974
AA Change: V183I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:p450 31 488 3.7e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206552
AA Change: V107I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to napthalene-induced toxicity in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Cyp2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Cyp2f2 APN 7 27121929 missense probably damaging 0.98
IGL00953:Cyp2f2 APN 7 27129817 missense possibly damaging 0.47
IGL01781:Cyp2f2 APN 7 27130421 missense probably benign 0.20
IGL02817:Cyp2f2 APN 7 27129315 missense probably damaging 1.00
IGL03027:Cyp2f2 APN 7 27132571 missense possibly damaging 0.95
R0464:Cyp2f2 UTSW 7 27132537 missense probably benign 0.00
R1481:Cyp2f2 UTSW 7 27121877 missense probably benign 0.00
R1635:Cyp2f2 UTSW 7 27129724 missense probably benign 0.11
R1826:Cyp2f2 UTSW 7 27132562 missense probably damaging 1.00
R1989:Cyp2f2 UTSW 7 27129203 missense probably damaging 1.00
R5098:Cyp2f2 UTSW 7 27129879 missense possibly damaging 0.52
R6305:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R6472:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R7132:Cyp2f2 UTSW 7 27132568 missense probably benign 0.00
R7599:Cyp2f2 UTSW 7 27131359 critical splice donor site probably null
R7814:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7823:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7824:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7825:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8142:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8143:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
X0064:Cyp2f2 UTSW 7 27133284 missense probably damaging 1.00
Z1177:Cyp2f2 UTSW 7 27121907 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACGGTGGGTGAATTCTGAGC -3'
(R):5'- AAGTTCTGCAAGGGTGGAAC -3'

Sequencing Primer
(F):5'- TTCTGAGCAAGCAGGAATCGTG -3'
(R):5'- TCAGGAACTTGTGGCAATCC -3'
Posted On2020-06-30