Mutagenetix > Incidental Mutations

Incidental Mutation 'R8141:Pnpla6'

632541

Institutional Source

Beutler Lab

Gene Symbol

Pnpla6

Ensembl Gene

ENSMUSG00000004565

Gene Name

patatin-like phospholipase domain containing 6

Synonyms

Nte, Swiss-cheese, MSws

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8141 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3515384-3544267 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3521384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 158 (S158P)

Ref Sequence

ENSEMBL: ENSMUSP00000146680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207146] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208310] [ENSMUST00000208762]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004681
AA Change: S136P

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: S136P

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
low complexity region	67	83	N/A	INTRINSIC
low complexity region	87	101	N/A	INTRINSIC
cNMP	147	272	3.17e-13	SMART
cNMP	465	584	3.17e-4	SMART
cNMP	587	703	3.45e-5	SMART
Blast:cNMP	742	777	7e-11	BLAST
Pfam:Patatin	933	1099	5e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111070
AA Change: S136P

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: S136P

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
low complexity region	67	83	N/A	INTRINSIC
low complexity region	87	101	N/A	INTRINSIC
cNMP	147	272	3.17e-13	SMART
cNMP	465	584	3.17e-4	SMART
cNMP	587	703	3.45e-5	SMART
Blast:cNMP	742	777	7e-11	BLAST
Pfam:Patatin	933	1099	1.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207146

Predicted Effect

probably benign
Transcript: ENSMUST00000207424
AA Change: S136P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000207941
AA Change: S168P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000208002
AA Change: S158P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000208310

Predicted Effect

probably benign
Transcript: ENSMUST00000208762

Meta Mutation Damage Score

0.1360

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.3%
20x: 90.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,258,405	T229A	probably benign	Het
4930438A08Rik	A	G	11: 58,286,585	E40G		Het
Actn2	T	C	13: 12,288,630	D428G	probably damaging	Het
Arl14epl	C	A	18: 46,926,343	N8K	probably benign	Het
Bend7	T	C	2: 4,752,825	V226A	probably benign	Het
C1s1	A	T	6: 124,531,362	L556Q	probably damaging	Het
Casr	T	C	16: 36,494,811	K966E	probably damaging	Het
Ccm2l	T	C	2: 153,070,871	L110P	probably damaging	Het
Cdhr4	G	A	9: 107,996,792	R59H		Het
Celf3	C	A	3: 94,488,543	N410K	probably damaging	Het
Cpne6	T	C	14: 55,512,609	C66R	possibly damaging	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Eln	CTCCAGCTCCGAT	C	5: 134,729,149		probably benign	Het
Fam53b	A	C	7: 132,760,029	V90G	probably damaging	Het
Fat3	T	A	9: 15,997,066	I2547F	possibly damaging	Het
Foxk1	A	G	5: 142,453,961	Y524C	probably damaging	Het
Gm884	T	C	11: 103,621,029	T38A	unknown	Het
Gpr87	A	G	3: 59,179,599	S162P	probably damaging	Het
Grasp	T	A	15: 101,231,909	C358S	possibly damaging	Het
Ifi204	A	G	1: 173,755,623	V343A	possibly damaging	Het
Igsf10	A	G	3: 59,330,528	L744P	probably damaging	Het
Iqub	T	A	6: 24,491,609	K359N	probably benign	Het
Kdm3b	A	T	18: 34,828,546	K1459*	probably null	Het
Kirrel	C	T	3: 87,086,428	W507*	probably null	Het
Klra17	T	C	6: 129,872,329	D94G	probably damaging	Het
Llgl1	G	C	11: 60,710,316	E693D	probably benign	Het
Lypd4	A	T	7: 24,864,829	D201E	possibly damaging	Het
Nin	A	G	12: 70,030,021	S1794P		Het
Olfr430	T	C	1: 174,069,922	L208P	probably damaging	Het
Oog2	T	C	4: 144,194,207	L70P	probably damaging	Het
Pacsin1	G	T	17: 27,707,060	R282S	possibly damaging	Het
Pcdhb9	T	A	18: 37,402,308	Y452N	probably damaging	Het
Pdgfra	T	C	5: 75,177,726	V547A	possibly damaging	Het
Plcb4	T	C	2: 135,939,249	F209L	probably damaging	Het
Prlhr	C	G	19: 60,467,309	R273P	probably damaging	Het
Prss41	G	A	17: 23,837,633	P196L	probably damaging	Het
Ptpn22	A	G	3: 103,886,327	E598G	possibly damaging	Het
Rasal2	T	C	1: 157,164,670	D569G	possibly damaging	Het
Sf3b3	A	C	8: 110,820,851	M715R	possibly damaging	Het
Ska1	T	C	18: 74,206,836	N13S	probably benign	Het
Spocd1	A	C	4: 129,929,704	E98A		Het
Sycp1	G	T	3: 102,935,569	A28E	possibly damaging	Het
Syf2	C	T	4: 134,936,871	R199C	probably damaging	Het
Syne2	A	G	12: 76,061,668	D942G	possibly damaging	Het
Tmem63a	A	G	1: 180,974,211	T764A	probably benign	Het
Ttf1	C	T	2: 29,067,226	Q503*	probably null	Het
Usp13	T	C	3: 32,894,876	V454A	possibly damaging	Het
Usp47	A	G	7: 112,053,265	T50A	possibly damaging	Het
Wdr66	T	G	5: 123,286,430	V726G	possibly damaging	Het
Zadh2	T	C	18: 84,094,526	L109P	probably benign	Het
Zfyve26	A	T	12: 79,268,557	C1382S	possibly damaging	Het

Other mutations in Pnpla6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Pnpla6	APN	8	3523808	missense	probably damaging	1.00
IGL00820:Pnpla6	APN	8	3532358	missense	possibly damaging	0.95
IGL00839:Pnpla6	APN	8	3542299	missense	probably benign	0.05
IGL01732:Pnpla6	APN	8	3522616	missense	probably damaging	0.99
IGL01973:Pnpla6	APN	8	3517619	missense	probably damaging	1.00
IGL02267:Pnpla6	APN	8	3517327	missense	probably benign	0.00
IGL03246:Pnpla6	APN	8	3531530	missense	probably benign	0.01
IGL03286:Pnpla6	APN	8	3531473	missense	probably damaging	0.99
Immemorial	UTSW	8	3531677	missense	probably benign	0.38
Mammilary	UTSW	8	3521384	missense	probably benign	0.01
I0000:Pnpla6	UTSW	8	3542322	missense	probably benign
R0141:Pnpla6	UTSW	8	3532117	critical splice donor site	probably null
R0180:Pnpla6	UTSW	8	3524250	critical splice acceptor site	probably null
R0377:Pnpla6	UTSW	8	3541501	missense	probably damaging	1.00
R0563:Pnpla6	UTSW	8	3523333	missense	possibly damaging	0.51
R0660:Pnpla6	UTSW	8	3522269	unclassified	probably benign
R0786:Pnpla6	UTSW	8	3523317	missense	probably benign
R0827:Pnpla6	UTSW	8	3517618	missense	possibly damaging	0.71
R0882:Pnpla6	UTSW	8	3517081	missense	probably damaging	1.00
R1512:Pnpla6	UTSW	8	3535459	splice site	probably benign
R1552:Pnpla6	UTSW	8	3522403	missense	probably damaging	1.00
R1609:Pnpla6	UTSW	8	3517135	missense	probably damaging	1.00
R1770:Pnpla6	UTSW	8	3534634	missense	possibly damaging	0.94
R1779:Pnpla6	UTSW	8	3541404	missense	probably damaging	1.00
R1987:Pnpla6	UTSW	8	3542370	missense	probably benign	0.00
R3079:Pnpla6	UTSW	8	3541512	missense	probably benign	0.25
R3125:Pnpla6	UTSW	8	3534670	missense	probably null	1.00
R4171:Pnpla6	UTSW	8	3543997	missense	probably benign	0.09
R4281:Pnpla6	UTSW	8	3521513	missense	probably damaging	1.00
R4674:Pnpla6	UTSW	8	3521412	missense	probably damaging	1.00
R4776:Pnpla6	UTSW	8	3523818	missense	probably benign	0.01
R4779:Pnpla6	UTSW	8	3522838	missense	probably benign	0.00
R5114:Pnpla6	UTSW	8	3522613	missense	probably damaging	0.98
R5459:Pnpla6	UTSW	8	3535829	missense	probably benign	0.01
R5510:Pnpla6	UTSW	8	3521397	missense	probably damaging	0.99
R5538:Pnpla6	UTSW	8	3531508	missense	probably benign	0.01
R5664:Pnpla6	UTSW	8	3537478	missense	probably damaging	0.98
R6063:Pnpla6	UTSW	8	3524156	missense	probably benign	0.21
R6314:Pnpla6	UTSW	8	3521572	missense	probably benign	0.39
R6321:Pnpla6	UTSW	8	3544015	missense	probably benign
R6454:Pnpla6	UTSW	8	3537986	missense	probably damaging	0.99
R6477:Pnpla6	UTSW	8	3536627	missense	probably benign	0.00
R6524:Pnpla6	UTSW	8	3534519	splice site	probably null
R6809:Pnpla6	UTSW	8	3534611	missense	possibly damaging	0.72
R6975:Pnpla6	UTSW	8	3538068	missense	probably damaging	1.00
R7293:Pnpla6	UTSW	8	3538068	missense	probably damaging	1.00
R7389:Pnpla6	UTSW	8	3543981	nonsense	probably null
R7426:Pnpla6	UTSW	8	3516540	splice site	probably null
R7520:Pnpla6	UTSW	8	3537508	missense	probably damaging	1.00
R7666:Pnpla6	UTSW	8	3541591	missense	probably benign	0.01
R7733:Pnpla6	UTSW	8	3522660	missense	probably benign	0.01
R7743:Pnpla6	UTSW	8	3536594	missense	possibly damaging	0.77
R7744:Pnpla6	UTSW	8	3531677	missense	probably benign	0.38
R7923:Pnpla6	UTSW	8	3531737	nonsense	probably null
R7980:Pnpla6	UTSW	8	3536562	missense	probably damaging	0.97
R8191:Pnpla6	UTSW	8	3542382	missense	probably benign	0.12
R8251:Pnpla6	UTSW	8	3532399	missense	probably benign	0.29
R8881:Pnpla6	UTSW	8	3531489	missense	probably benign	0.00
R8917:Pnpla6	UTSW	8	3517637	missense	possibly damaging	0.50
R8939:Pnpla6	UTSW	8	3521319	missense	possibly damaging	0.86
R8988:Pnpla6	UTSW	8	3517401	missense	possibly damaging	0.51
R9037:Pnpla6	UTSW	8	3542379	nonsense	probably null
R9264:Pnpla6	UTSW	8	3523294	missense	probably benign
R9265:Pnpla6	UTSW	8	3523294	missense	probably benign
R9386:Pnpla6	UTSW	8	3521417	critical splice donor site	probably null
X0018:Pnpla6	UTSW	8	3517337	missense	probably damaging	1.00
Z1177:Pnpla6	UTSW	8	3536979	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AAGGATTAAATGGGTGTCTTAGTTC -3'
(R):5'- AGACGCTGGAAGACCATGTG -3'

Sequencing Primer
(F):5'- TAAGGCCATCTGCATGTCAG -3'
(R):5'- AAGACCATGTGCCGGCAG -3'

Posted On

2020-06-30