Incidental Mutation 'R8141:Sf3b3'
ID632542
Institutional Source Beutler Lab
Gene Symbol Sf3b3
Ensembl Gene ENSMUSG00000033732
Gene Namesplicing factor 3b, subunit 3
Synonyms5730409A01Rik, 1810061H24Rik, D8Ertd633e, SAP130, RSE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8141 (G1)
Quality Score209.009
Status Validated
Chromosome8
Chromosomal Location110810239-110846787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 110820851 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 715 (M715R)
Ref Sequence ENSEMBL: ENSMUSP00000045073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042012
AA Change: M715R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045073
Gene: ENSMUSG00000033732
AA Change: M715R

DomainStartEndE-ValueType
Blast:SH3 17 70 5e-13 BLAST
Pfam:MMS1_N 76 592 3.2e-185 PFAM
low complexity region 716 728 N/A INTRINSIC
Pfam:CPSF_A 863 1184 4.3e-104 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Sf3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Sf3b3 APN 8 110813751 nonsense probably null
IGL00770:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL00774:Sf3b3 APN 8 110817638 missense probably damaging 0.96
IGL01132:Sf3b3 APN 8 110842781 missense probably benign
IGL01487:Sf3b3 APN 8 110817660 missense probably benign 0.01
IGL02015:Sf3b3 APN 8 110816290 missense possibly damaging 0.82
IGL02126:Sf3b3 APN 8 110823443 missense probably benign
IGL02612:Sf3b3 APN 8 110842976 missense probably benign
IGL02833:Sf3b3 APN 8 110811977 critical splice donor site probably null
IGL03033:Sf3b3 APN 8 110810964 missense possibly damaging 0.62
IGL03366:Sf3b3 APN 8 110839954 missense probably damaging 1.00
R0458:Sf3b3 UTSW 8 110812136 splice site probably benign
R0907:Sf3b3 UTSW 8 110811510 splice site probably benign
R1344:Sf3b3 UTSW 8 110838303 missense probably damaging 0.98
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1468:Sf3b3 UTSW 8 110837374 missense probably damaging 1.00
R1736:Sf3b3 UTSW 8 110813832 missense probably benign
R1833:Sf3b3 UTSW 8 110817566 missense probably benign
R2225:Sf3b3 UTSW 8 110814573 missense probably damaging 1.00
R3236:Sf3b3 UTSW 8 110812020 missense probably damaging 0.99
R3615:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3616:Sf3b3 UTSW 8 110844523 missense probably damaging 1.00
R3683:Sf3b3 UTSW 8 110813621 critical splice donor site probably null
R4197:Sf3b3 UTSW 8 110821565 missense probably damaging 0.98
R4429:Sf3b3 UTSW 8 110826118 missense probably benign 0.01
R4674:Sf3b3 UTSW 8 110844505 missense probably damaging 0.99
R4895:Sf3b3 UTSW 8 110816024 missense probably benign 0.00
R4931:Sf3b3 UTSW 8 110816329 missense probably benign 0.00
R4948:Sf3b3 UTSW 8 110813669 missense probably damaging 0.99
R4999:Sf3b3 UTSW 8 110841203 missense probably benign 0.34
R5150:Sf3b3 UTSW 8 110823376 missense possibly damaging 0.88
R5175:Sf3b3 UTSW 8 110833835 missense probably benign
R5559:Sf3b3 UTSW 8 110838215 missense probably benign 0.00
R5866:Sf3b3 UTSW 8 110814634 missense probably benign
R5934:Sf3b3 UTSW 8 110823470 missense probably damaging 0.99
R6270:Sf3b3 UTSW 8 110841820 missense probably damaging 1.00
R6803:Sf3b3 UTSW 8 110825578 missense probably benign 0.01
R7078:Sf3b3 UTSW 8 110813007 missense possibly damaging 0.90
R7252:Sf3b3 UTSW 8 110839930 missense probably damaging 0.99
R7467:Sf3b3 UTSW 8 110811456 missense possibly damaging 0.89
R7523:Sf3b3 UTSW 8 110813720 missense probably benign 0.35
R7544:Sf3b3 UTSW 8 110838283 missense probably benign 0.01
R7638:Sf3b3 UTSW 8 110820813 missense probably damaging 1.00
R7934:Sf3b3 UTSW 8 110821530 missense probably benign 0.05
R7973:Sf3b3 UTSW 8 110816290 missense possibly damaging 0.82
X0024:Sf3b3 UTSW 8 110842932 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTTCAAGCCTGAGGATTTTCTC -3'
(R):5'- CGGTCCAGAGGAATGTGATTG -3'

Sequencing Primer
(F):5'- TGGCTGTCCTGGAACTCAGAAATC -3'
(R):5'- AGGAATGTGATTGATAAAGCTTGC -3'
Posted On2020-06-30