Incidental Mutation 'R8141:1700017B05Rik'
ID632544
Institutional Source Beutler Lab
Gene Symbol 1700017B05Rik
Ensembl Gene ENSMUSG00000032300
Gene NameRIKEN cDNA 1700017B05 gene
SynonymsD9Ertd278e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57253117-57262612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57258405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 229 (T229A)
Ref Sequence ENSEMBL: ENSMUSP00000034846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000213199] [ENSMUST00000215298] [ENSMUST00000217657]
Predicted Effect probably benign
Transcript: ENSMUST00000034846
AA Change: T229A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300
AA Change: T229A

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213199
AA Change: T229A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably null
Transcript: ENSMUST00000215298
Predicted Effect probably benign
Transcript: ENSMUST00000217657
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in 1700017B05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:1700017B05Rik APN 9 57258246 missense probably damaging 1.00
IGL01287:1700017B05Rik APN 9 57257757 missense probably damaging 1.00
IGL01798:1700017B05Rik APN 9 57256638 missense probably benign 0.10
IGL01933:1700017B05Rik APN 9 57257367 missense possibly damaging 0.95
IGL02146:1700017B05Rik APN 9 57256740 missense possibly damaging 0.82
IGL02158:1700017B05Rik APN 9 57256619 splice site probably null
IGL02277:1700017B05Rik APN 9 57258425 missense probably benign 0.05
IGL02707:1700017B05Rik APN 9 57258645 missense probably benign
IGL02887:1700017B05Rik APN 9 57258885 missense probably damaging 1.00
IGL02936:1700017B05Rik APN 9 57258404 missense possibly damaging 0.69
R0583:1700017B05Rik UTSW 9 57257643 missense probably benign 0.04
R0926:1700017B05Rik UTSW 9 57257549 missense probably damaging 0.99
R1812:1700017B05Rik UTSW 9 57257457 nonsense probably null
R1903:1700017B05Rik UTSW 9 57258352 missense possibly damaging 0.69
R4542:1700017B05Rik UTSW 9 57256592 missense probably damaging 1.00
R4596:1700017B05Rik UTSW 9 57257805 missense probably benign 0.03
R4631:1700017B05Rik UTSW 9 57257987 missense probably damaging 1.00
R4869:1700017B05Rik UTSW 9 57254205 missense probably damaging 1.00
R5265:1700017B05Rik UTSW 9 57258894 missense probably damaging 1.00
R5361:1700017B05Rik UTSW 9 57257185 missense probably damaging 1.00
R6216:1700017B05Rik UTSW 9 57257627 missense probably benign 0.33
R6356:1700017B05Rik UTSW 9 57254009 missense probably benign 0.11
R6579:1700017B05Rik UTSW 9 57254224 missense possibly damaging 0.89
R6774:1700017B05Rik UTSW 9 57256625 missense probably damaging 1.00
R6921:1700017B05Rik UTSW 9 57258736 missense probably damaging 1.00
R7089:1700017B05Rik UTSW 9 57258758 missense probably damaging 1.00
R7196:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7197:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7728:1700017B05Rik UTSW 9 57256539 missense probably damaging 1.00
R7770:1700017B05Rik UTSW 9 57258611 missense probably damaging 0.99
R7812:1700017B05Rik UTSW 9 57257858 missense probably damaging 0.99
R8144:1700017B05Rik UTSW 9 57259105 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTGGATGACAAGATGGAGG -3'
(R):5'- ATCATTGGATGGTGACTGGACC -3'

Sequencing Primer
(F):5'- TGACAAGATGGAGGGCAAGGC -3'
(R):5'- TGACTGGACCCTGGTGAC -3'
Posted On2020-06-30