Incidental Mutation 'R8141:Gm884'
ID632548
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103621029 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: T38A
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: T38A

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
R8053:Gm884 UTSW 11 103604566 missense unknown
R8063:Gm884 UTSW 11 103542261 missense unknown
R8116:Gm884 UTSW 11 103543289 missense unknown
R8124:Gm884 UTSW 11 103620431 missense unknown
R8163:Gm884 UTSW 11 103615862 missense unknown
R8270:Gm884 UTSW 11 103543315 missense unknown
R8348:Gm884 UTSW 11 103620900 missense unknown
R8362:Gm884 UTSW 11 103615337 missense probably benign 0.34
R8448:Gm884 UTSW 11 103620900 missense unknown
Z1176:Gm884 UTSW 11 103613681 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACTGAGGTTTTCCAACAACCAC -3'
(R):5'- TAGAGCCGCACATACTCGAATATC -3'

Sequencing Primer
(F):5'- GAGGTTTTCCAACAACCACTTTAGC -3'
(R):5'- TCGAATATCCAAGACAGACACAGGG -3'
Posted On2020-06-30