Mutagenetix > Incidental Mutation

Incidental Mutation 'R8141:Zfyve26'

632551

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, 9330197E15Rik, LOC380767

MMRRC Submission

067569-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8141 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79279120-79343078 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79315331 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1382 (C1382S)

Ref Sequence

ENSEMBL: ENSMUSP00000021547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]

AlphaFold

Q5DU37

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021547
AA Change: C1382S

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: C1382S

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

probably benign
Transcript: ENSMUST00000219912

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.3%
20x: 90.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,165,688 (GRCm39)	T229A	probably benign	Het
4930438A08Rik	A	G	11: 58,177,411 (GRCm39)	E40G		Het
Actn2	T	C	13: 12,303,516 (GRCm39)	D428G	probably damaging	Het
Arl14epl	C	A	18: 47,059,410 (GRCm39)	N8K	probably benign	Het
Bend7	T	C	2: 4,757,636 (GRCm39)	V226A	probably benign	Het
C1s1	A	T	6: 124,508,321 (GRCm39)	L556Q	probably damaging	Het
Casr	T	C	16: 36,315,173 (GRCm39)	K966E	probably damaging	Het
Ccm2l	T	C	2: 152,912,791 (GRCm39)	L110P	probably damaging	Het
Cdhr4	G	A	9: 107,873,991 (GRCm39)	R59H		Het
Celf3	C	A	3: 94,395,850 (GRCm39)	N410K	probably damaging	Het
Cfap251	T	G	5: 123,424,493 (GRCm39)	V726G	possibly damaging	Het
Cpne6	T	C	14: 55,750,066 (GRCm39)	C66R	possibly damaging	Het
Cyp2f2	G	A	7: 26,828,678 (GRCm39)	V183I	probably benign	Het
Eln	CTCCAGCTCCGAT	C	5: 134,758,003 (GRCm39)		probably benign	Het
Fam53b	A	C	7: 132,361,758 (GRCm39)	V90G	probably damaging	Het
Fat3	T	A	9: 15,908,362 (GRCm39)	I2547F	possibly damaging	Het
Foxk1	A	G	5: 142,439,716 (GRCm39)	Y524C	probably damaging	Het
Gpr87	A	G	3: 59,087,020 (GRCm39)	S162P	probably damaging	Het
Ifi204	A	G	1: 173,583,189 (GRCm39)	V343A	possibly damaging	Het
Igsf10	A	G	3: 59,237,949 (GRCm39)	L744P	probably damaging	Het
Iqub	T	A	6: 24,491,608 (GRCm39)	K359N	probably benign	Het
Kdm3b	A	T	18: 34,961,599 (GRCm39)	K1459*	probably null	Het
Kirrel1	C	T	3: 86,993,735 (GRCm39)	W507*	probably null	Het
Klra17	T	C	6: 129,849,292 (GRCm39)	D94G	probably damaging	Het
Llgl1	G	C	11: 60,601,142 (GRCm39)	E693D	probably benign	Het
Lrrc37	T	C	11: 103,511,855 (GRCm39)	T38A	unknown	Het
Lypd4	A	T	7: 24,564,254 (GRCm39)	D201E	possibly damaging	Het
Nin	A	G	12: 70,076,795 (GRCm39)	S1794P		Het
Oog2	T	C	4: 143,920,777 (GRCm39)	L70P	probably damaging	Het
Or6n2	T	C	1: 173,897,488 (GRCm39)	L208P	probably damaging	Het
Pacsin1	G	T	17: 27,926,034 (GRCm39)	R282S	possibly damaging	Het
Pcdhb9	T	A	18: 37,535,361 (GRCm39)	Y452N	probably damaging	Het
Pdgfra	T	C	5: 75,338,387 (GRCm39)	V547A	possibly damaging	Het
Plcb4	T	C	2: 135,781,169 (GRCm39)	F209L	probably damaging	Het
Pnpla6	T	C	8: 3,571,384 (GRCm39)	S158P	probably benign	Het
Prlhr	C	G	19: 60,455,747 (GRCm39)	R273P	probably damaging	Het
Prss41	G	A	17: 24,056,607 (GRCm39)	P196L	probably damaging	Het
Ptgr3	T	C	18: 84,112,651 (GRCm39)	L109P	probably benign	Het
Ptpn22	A	G	3: 103,793,643 (GRCm39)	E598G	possibly damaging	Het
Rasal2	T	C	1: 156,992,240 (GRCm39)	D569G	possibly damaging	Het
Sf3b3	A	C	8: 111,547,483 (GRCm39)	M715R	possibly damaging	Het
Ska1	T	C	18: 74,339,907 (GRCm39)	N13S	probably benign	Het
Spocd1	A	C	4: 129,823,497 (GRCm39)	E98A		Het
Sycp1	G	T	3: 102,842,885 (GRCm39)	A28E	possibly damaging	Het
Syf2	C	T	4: 134,664,182 (GRCm39)	R199C	probably damaging	Het
Syne2	A	G	12: 76,108,442 (GRCm39)	D942G	possibly damaging	Het
Tamalin	T	A	15: 101,129,790 (GRCm39)	C358S	possibly damaging	Het
Tmem63a	A	G	1: 180,801,776 (GRCm39)	T764A	probably benign	Het
Ttf1	C	T	2: 28,957,238 (GRCm39)	Q503*	probably null	Het
Usp13	T	C	3: 32,949,025 (GRCm39)	V454A	possibly damaging	Het
Usp47	A	G	7: 111,652,472 (GRCm39)	T50A	possibly damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79,296,234 (GRCm39)	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79,327,674 (GRCm39)	missense	probably benign
IGL01148:Zfyve26	APN	12	79,307,644 (GRCm39)	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79,298,957 (GRCm39)	splice site	probably null
IGL01472:Zfyve26	APN	12	79,323,117 (GRCm39)	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79,291,147 (GRCm39)	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79,334,625 (GRCm39)	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79,308,348 (GRCm39)	splice site	probably null
IGL01689:Zfyve26	APN	12	79,330,827 (GRCm39)	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79,334,218 (GRCm39)	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79,291,174 (GRCm39)	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79,323,169 (GRCm39)	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79,315,621 (GRCm39)	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79,326,854 (GRCm39)	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79,285,794 (GRCm39)	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79,310,644 (GRCm39)	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79,308,565 (GRCm39)	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79,342,338 (GRCm39)	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79,330,846 (GRCm39)	nonsense	probably null
challenge	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
fourteener	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79,320,084 (GRCm39)	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79,323,055 (GRCm39)	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79,291,258 (GRCm39)	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79,292,996 (GRCm39)	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79,315,502 (GRCm39)	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79,312,576 (GRCm39)	splice site	probably benign
R0738:Zfyve26	UTSW	12	79,342,308 (GRCm39)	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79,320,372 (GRCm39)	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79,318,901 (GRCm39)	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79,326,841 (GRCm39)	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79,310,723 (GRCm39)	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79,321,694 (GRCm39)	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79,329,591 (GRCm39)	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79,298,937 (GRCm39)	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79,298,925 (GRCm39)	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79,334,535 (GRCm39)	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79,285,718 (GRCm39)	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79,325,237 (GRCm39)	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79,315,823 (GRCm39)	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79,333,032 (GRCm39)	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79,308,573 (GRCm39)	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79,311,125 (GRCm39)	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79,286,744 (GRCm39)	nonsense	probably null
R1982:Zfyve26	UTSW	12	79,302,017 (GRCm39)	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79,330,806 (GRCm39)	splice site	probably null
R2071:Zfyve26	UTSW	12	79,334,220 (GRCm39)	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79,315,208 (GRCm39)	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79,292,826 (GRCm39)	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79,292,861 (GRCm39)	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79,321,814 (GRCm39)	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79,330,890 (GRCm39)	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79,329,573 (GRCm39)	splice site	probably null
R3084:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R3086:Zfyve26	UTSW	12	79,312,457 (GRCm39)	splice site	probably benign
R4626:Zfyve26	UTSW	12	79,315,844 (GRCm39)	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79,291,170 (GRCm39)	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79,296,469 (GRCm39)	splice site	probably null
R4926:Zfyve26	UTSW	12	79,321,785 (GRCm39)	missense	probably benign
R4990:Zfyve26	UTSW	12	79,334,607 (GRCm39)	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79,327,159 (GRCm39)	nonsense	probably null
R5029:Zfyve26	UTSW	12	79,333,097 (GRCm39)	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79,302,135 (GRCm39)	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79,326,832 (GRCm39)	nonsense	probably null
R5252:Zfyve26	UTSW	12	79,315,756 (GRCm39)	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79,317,624 (GRCm39)	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79,293,295 (GRCm39)	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79,286,698 (GRCm39)	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79,320,147 (GRCm39)	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79,311,131 (GRCm39)	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79,334,511 (GRCm39)	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79,313,311 (GRCm39)	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79,340,628 (GRCm39)	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79,315,501 (GRCm39)	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79,296,373 (GRCm39)	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79,286,776 (GRCm39)	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79,285,109 (GRCm39)	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79,313,223 (GRCm39)	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79,330,926 (GRCm39)	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79,325,888 (GRCm39)	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79,327,179 (GRCm39)	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79,315,182 (GRCm39)	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79,292,945 (GRCm39)	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79,325,146 (GRCm39)	splice site	probably null
R7299:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79,329,758 (GRCm39)	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79,297,942 (GRCm39)	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79,286,828 (GRCm39)	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79,334,581 (GRCm39)	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79,315,450 (GRCm39)	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79,337,731 (GRCm39)	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79,315,409 (GRCm39)	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79,327,129 (GRCm39)	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79,302,098 (GRCm39)	missense	probably damaging	1.00
R8190:Zfyve26	UTSW	12	79,327,610 (GRCm39)	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79,307,605 (GRCm39)	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79,302,037 (GRCm39)	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79,334,454 (GRCm39)	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79,334,227 (GRCm39)	missense	probably benign
R8758:Zfyve26	UTSW	12	79,311,083 (GRCm39)	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79,285,742 (GRCm39)	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79,334,152 (GRCm39)	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79,318,915 (GRCm39)	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79,311,168 (GRCm39)	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79,323,076 (GRCm39)	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79,317,610 (GRCm39)	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79,321,680 (GRCm39)	nonsense	probably null
R9348:Zfyve26	UTSW	12	79,315,231 (GRCm39)	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79,291,239 (GRCm39)	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79,298,046 (GRCm39)	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79,334,418 (GRCm39)	missense	probably benign
R9676:Zfyve26	UTSW	12	79,330,959 (GRCm39)	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79,293,006 (GRCm39)	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79,302,112 (GRCm39)	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79,285,779 (GRCm39)	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79,315,307 (GRCm39)	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79,334,149 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTACAATGCTCAGGTCATC -3'
(R):5'- TCAAAGATACTGGCCATGGTG -3'

Sequencing Primer
(F):5'- AATGCTCAGGTCATCCAAGTCTTG -3'
(R):5'- ACTTCCCGAGGGACAAAGGTC -3'

Posted On

2020-06-30