Incidental Mutation 'R8141:Grasp'
ID632555
Institutional Source Beutler Lab
Gene Symbol Grasp
Ensembl Gene ENSMUSG00000000531
Gene NameGRP1 (general receptor for phosphoinositides 1)-associated scaffold protein
Synonymstamalin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8141 (G1)
Quality Score81.0075
Status Validated
Chromosome15
Chromosomal Location101224188-101232756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101231909 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 358 (C358S)
Ref Sequence ENSEMBL: ENSMUSP00000000543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000543
AA Change: C358S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000543
Gene: ENSMUSG00000000531
AA Change: C358S

DomainStartEndE-ValueType
low complexity region 30 57 N/A INTRINSIC
PDZ 109 189 2.12e-13 SMART
low complexity region 248 277 N/A INTRINSIC
low complexity region 291 312 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a molecular scaffold, linking receptors, including group 1 metabotropic glutamate receptors, to neuronal proteins. The encoded protein contains conserved domains, including a leucine zipper sequence, PDZ domain and a C-terminal PDZ-binding motif. Alternately spliced transcript variants have been observed for this gene.[provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted null mutations develop and behave normally under ordinary conditions but display a marked reduction in sensitivity to acute morphine responses and impaired adaptive responses to morphine and cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Grasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Grasp APN 15 101228896 splice site probably benign
IGL02069:Grasp APN 15 101224465 missense probably damaging 1.00
IGL02516:Grasp APN 15 101229051 missense probably damaging 1.00
IGL02997:Grasp APN 15 101231018 missense probably damaging 1.00
IGL03079:Grasp APN 15 101230567 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R0020:Grasp UTSW 15 101230552 missense probably damaging 1.00
R1916:Grasp UTSW 15 101226969 splice site probably benign
R1952:Grasp UTSW 15 101224500 missense probably benign 0.07
R4247:Grasp UTSW 15 101224537 missense possibly damaging 0.55
R5040:Grasp UTSW 15 101229042 missense probably damaging 1.00
R5117:Grasp UTSW 15 101230537 missense probably damaging 1.00
R7290:Grasp UTSW 15 101231538 missense probably damaging 1.00
R8239:Grasp UTSW 15 101231021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCACACGTGCTTCTTTGGG -3'
(R):5'- TGTTCAGCAGACAAGCCAATG -3'

Sequencing Primer
(F):5'- CTTCTTTGGGGGCGCCG -3'
(R):5'- GTCCTTGGACCGACACTAC -3'
Posted On2020-06-30