Incidental Mutation 'R8141:Casr'
ID632556
Institutional Source Beutler Lab
Gene Symbol Casr
Ensembl Gene ENSMUSG00000051980
Gene Namecalcium-sensing receptor
SynonymsCaR, cation sensing receptor, Gprc2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8141 (G1)
Quality Score219.009
Status Validated
Chromosome16
Chromosomal Location36493696-36562141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36494811 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 966 (K966E)
Ref Sequence ENSEMBL: ENSMUSP00000069080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063597] [ENSMUST00000114847] [ENSMUST00000172826]
Predicted Effect probably damaging
Transcript: ENSMUST00000063597
AA Change: K966E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069080
Gene: ENSMUSG00000051980
AA Change: K966E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 1e-13 PFAM
Pfam:ANF_receptor 69 495 1.1e-114 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 624 859 7.4e-61 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114847
AA Change: K889E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110496
Gene: ENSMUSG00000051980
AA Change: K889E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.1e-14 PFAM
Pfam:ANF_receptor 69 461 2.8e-99 PFAM
Pfam:NCD3G 461 514 1.2e-20 PFAM
Pfam:7tm_3 545 783 9.9e-87 PFAM
low complexity region 817 843 N/A INTRINSIC
low complexity region 853 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172826
AA Change: K966E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133500
Gene: ENSMUSG00000051980
AA Change: K966E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Peripla_BP_6 63 321 2.4e-14 PFAM
Pfam:ANF_receptor 69 495 3.9e-111 PFAM
Pfam:NCD3G 538 591 1.4e-20 PFAM
Pfam:7tm_3 622 860 1.1e-86 PFAM
low complexity region 894 920 N/A INTRINSIC
low complexity region 930 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high levels of serum calcium and parathyroid hormone, parathyroid hyperplasia, bone defects, reduced growth, and early death. Carriers have elevated serum calcium, magnesium, and parathyroid hormone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Casr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Casr APN 16 36495810 missense probably damaging 1.00
IGL01587:Casr APN 16 36509765 missense probably benign
IGL02323:Casr APN 16 36509710 missense probably damaging 1.00
IGL02369:Casr APN 16 36494689 missense probably benign 0.03
IGL02514:Casr APN 16 36500325 missense probably damaging 1.00
IGL02547:Casr APN 16 36515674 missense probably benign 0.06
IGL02633:Casr APN 16 36515655 missense probably damaging 1.00
IGL03061:Casr APN 16 36495888 missense probably benign 0.07
R1163:Casr UTSW 16 36494807 missense probably damaging 1.00
R1539:Casr UTSW 16 36495137 missense probably benign 0.10
R1643:Casr UTSW 16 36500205 missense probably damaging 1.00
R1664:Casr UTSW 16 36509965 nonsense probably null
R1694:Casr UTSW 16 36495591 missense probably damaging 1.00
R2040:Casr UTSW 16 36510366 missense possibly damaging 0.79
R2092:Casr UTSW 16 36510043 missense possibly damaging 0.96
R2125:Casr UTSW 16 36495252 missense possibly damaging 0.90
R2190:Casr UTSW 16 36495416 missense probably damaging 1.00
R2214:Casr UTSW 16 36515758 missense probably damaging 1.00
R4409:Casr UTSW 16 36500341 missense probably benign 0.01
R4410:Casr UTSW 16 36500341 missense probably benign 0.01
R4591:Casr UTSW 16 36500370 missense probably benign 0.05
R5451:Casr UTSW 16 36509908 missense probably damaging 0.99
R5469:Casr UTSW 16 36510030 missense probably benign 0.29
R5581:Casr UTSW 16 36494744 missense probably benign 0.01
R5700:Casr UTSW 16 36509617 missense probably damaging 0.99
R6258:Casr UTSW 16 36517609 missense probably damaging 1.00
R6447:Casr UTSW 16 36495545 missense probably damaging 1.00
R6751:Casr UTSW 16 36515588 missense probably benign 0.00
R6938:Casr UTSW 16 36495921 missense probably damaging 1.00
R7063:Casr UTSW 16 36494574 missense probably benign 0.00
R7313:Casr UTSW 16 36509671 missense probably damaging 1.00
R7789:Casr UTSW 16 36495291 missense probably damaging 1.00
R8013:Casr UTSW 16 36509644 missense probably benign 0.22
R8026:Casr UTSW 16 36495617 missense probably damaging 1.00
R8184:Casr UTSW 16 36509746 missense probably benign
R8278:Casr UTSW 16 36515649 missense probably damaging 1.00
R8386:Casr UTSW 16 36515588 missense probably damaging 0.96
R8393:Casr UTSW 16 36510204 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGCACACTGTAGGGGAAG -3'
(R):5'- CGGCTCATGCTTTCAAAGTG -3'

Sequencing Primer
(F):5'- AAGCAGGGCCTGGTGTCTG -3'
(R):5'- ATGCTTTCAAAGTGGCAGCC -3'
Posted On2020-06-30