Incidental Mutation 'R8141:Ska1'
ID632562
Institutional Source Beutler Lab
Gene Symbol Ska1
Ensembl Gene ENSMUSG00000036223
Gene Namespindle and kinetochore associated complex subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R8141 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location74195299-74207818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74206836 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 13 (N13S)
Ref Sequence ENSEMBL: ENSMUSP00000049156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040188] [ENSMUST00000177604]
Predicted Effect probably benign
Transcript: ENSMUST00000040188
AA Change: N13S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049156
Gene: ENSMUSG00000036223
AA Change: N13S

DomainStartEndE-ValueType
Pfam:DUF1395 15 247 2.2e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177604
AA Change: N13S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137357
Gene: ENSMUSG00000036223
AA Change: N13S

DomainStartEndE-ValueType
Pfam:DUF1395 15 249 6.2e-106 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prlhr C G 19: 60,467,309 R273P probably damaging Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Ska1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Ska1 APN 18 74196910 missense possibly damaging 0.88
IGL02685:Ska1 APN 18 74197048 missense probably benign 0.00
R0831:Ska1 UTSW 18 74197499 splice site probably benign
R2087:Ska1 UTSW 18 74206849 missense probably benign 0.06
R2232:Ska1 UTSW 18 74197066 splice site probably null
R4658:Ska1 UTSW 18 74197040 missense probably benign 0.01
R5671:Ska1 UTSW 18 74196996 missense probably damaging 1.00
R5876:Ska1 UTSW 18 74197528 missense probably damaging 1.00
R6019:Ska1 UTSW 18 74199921 missense probably benign 0.13
R6049:Ska1 UTSW 18 74202600 missense probably benign 0.00
R6885:Ska1 UTSW 18 74206839 missense probably benign 0.41
R7549:Ska1 UTSW 18 74200017 missense probably benign 0.01
R7701:Ska1 UTSW 18 74202643 missense probably damaging 1.00
R7757:Ska1 UTSW 18 74196973 missense probably benign 0.00
R8266:Ska1 UTSW 18 74204341 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCTGCATTATTCAAGACAGTGACAC -3'
(R):5'- CCTCCAAGACACGTTAGCATTG -3'

Sequencing Primer
(F):5'- ACGTATTGTGCTTACCCC -3'
(R):5'- GTGAACAGAAATTTGGCTTTA -3'
Posted On2020-06-30