Incidental Mutation 'R8141:Prlhr'
ID632564
Institutional Source Beutler Lab
Gene Symbol Prlhr
Ensembl Gene ENSMUSG00000045052
Gene Nameprolactin releasing hormone receptor
SynonymsGpr10, LOC226278, PrRPR, GR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R8141 (G1)
Quality Score180.009
Status Validated
Chromosome19
Chromosomal Location60466733-60468304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 60467309 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 273 (R273P)
Ref Sequence ENSEMBL: ENSMUSP00000063114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051277]
Predicted Effect probably damaging
Transcript: ENSMUST00000051277
AA Change: R273P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063114
Gene: ENSMUSG00000045052
AA Change: R273P

DomainStartEndE-ValueType
Pfam:7tm_4 67 352 4.8e-9 PFAM
Pfam:7TM_GPCR_Srsx 71 350 7.4e-16 PFAM
Pfam:7tm_1 77 335 2.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 90.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PRLHR is a 7-transmembrane domain receptor for prolactin-releasing hormone (PRLH; MIM 602663) that is highly expressed in anterior pituitary (Ozawa et al., 2002 [PubMed 11923475]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene ate more than normal and became obese as they aged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,258,405 T229A probably benign Het
4930438A08Rik A G 11: 58,286,585 E40G Het
Actn2 T C 13: 12,288,630 D428G probably damaging Het
Arl14epl C A 18: 46,926,343 N8K probably benign Het
Bend7 T C 2: 4,752,825 V226A probably benign Het
C1s1 A T 6: 124,531,362 L556Q probably damaging Het
Casr T C 16: 36,494,811 K966E probably damaging Het
Ccm2l T C 2: 153,070,871 L110P probably damaging Het
Cdhr4 G A 9: 107,996,792 R59H Het
Celf3 C A 3: 94,488,543 N410K probably damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Fam53b A C 7: 132,760,029 V90G probably damaging Het
Fat3 T A 9: 15,997,066 I2547F possibly damaging Het
Foxk1 A G 5: 142,453,961 Y524C probably damaging Het
Gm884 T C 11: 103,621,029 T38A unknown Het
Gpr87 A G 3: 59,179,599 S162P probably damaging Het
Grasp T A 15: 101,231,909 C358S possibly damaging Het
Ifi204 A G 1: 173,755,623 V343A possibly damaging Het
Igsf10 A G 3: 59,330,528 L744P probably damaging Het
Iqub T A 6: 24,491,609 K359N probably benign Het
Kdm3b A T 18: 34,828,546 K1459* probably null Het
Kirrel C T 3: 87,086,428 W507* probably null Het
Klra17 T C 6: 129,872,329 D94G probably damaging Het
Llgl1 G C 11: 60,710,316 E693D probably benign Het
Lypd4 A T 7: 24,864,829 D201E possibly damaging Het
Nin A G 12: 70,030,021 S1794P Het
Olfr430 T C 1: 174,069,922 L208P probably damaging Het
Oog2 T C 4: 144,194,207 L70P probably damaging Het
Pacsin1 G T 17: 27,707,060 R282S possibly damaging Het
Pcdhb9 T A 18: 37,402,308 Y452N probably damaging Het
Pdgfra T C 5: 75,177,726 V547A possibly damaging Het
Plcb4 T C 2: 135,939,249 F209L probably damaging Het
Pnpla6 T C 8: 3,521,384 S158P probably benign Het
Prss41 G A 17: 23,837,633 P196L probably damaging Het
Ptpn22 A G 3: 103,886,327 E598G possibly damaging Het
Rasal2 T C 1: 157,164,670 D569G possibly damaging Het
Sf3b3 A C 8: 110,820,851 M715R possibly damaging Het
Ska1 T C 18: 74,206,836 N13S probably benign Het
Spocd1 A C 4: 129,929,704 E98A Het
Sycp1 G T 3: 102,935,569 A28E possibly damaging Het
Syf2 C T 4: 134,936,871 R199C probably damaging Het
Syne2 A G 12: 76,061,668 D942G possibly damaging Het
Tmem63a A G 1: 180,974,211 T764A probably benign Het
Ttf1 C T 2: 29,067,226 Q503* probably null Het
Usp13 T C 3: 32,894,876 V454A possibly damaging Het
Usp47 A G 7: 112,053,265 T50A possibly damaging Het
Wdr66 T G 5: 123,286,430 V726G possibly damaging Het
Zadh2 T C 18: 84,094,526 L109P probably benign Het
Zfyve26 A T 12: 79,268,557 C1382S possibly damaging Het
Other mutations in Prlhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prlhr APN 19 60467681 missense probably damaging 1.00
IGL02306:Prlhr APN 19 60467915 missense probably damaging 1.00
IGL02398:Prlhr APN 19 60467315 missense probably damaging 1.00
IGL02506:Prlhr APN 19 60467928 missense probably damaging 1.00
R0718:Prlhr UTSW 19 60468005 missense probably benign 0.00
R0718:Prlhr UTSW 19 60468059 nonsense probably null
R1829:Prlhr UTSW 19 60467429 missense probably damaging 1.00
R1886:Prlhr UTSW 19 60467494 nonsense probably null
R4493:Prlhr UTSW 19 60467081 missense probably benign 0.04
R4494:Prlhr UTSW 19 60467081 missense probably benign 0.04
R4495:Prlhr UTSW 19 60467081 missense probably benign 0.04
R5762:Prlhr UTSW 19 60467068 nonsense probably null
R5869:Prlhr UTSW 19 60467621 missense probably damaging 0.96
R5886:Prlhr UTSW 19 60467576 nonsense probably null
R7651:Prlhr UTSW 19 60467145 missense probably benign 0.13
R7809:Prlhr UTSW 19 60467855 missense probably damaging 1.00
R8337:Prlhr UTSW 19 60467846 missense possibly damaging 0.88
Z1177:Prlhr UTSW 19 60467315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCATAGATGAAGGGGTTG -3'
(R):5'- CCTACCATGTGGAGCTCAAG -3'

Sequencing Primer
(F):5'- TGCATAGATGAAGGGGTTGTAGCAG -3'
(R):5'- TCAAGCCCCACGACGTGAG -3'
Posted On2020-06-30