Incidental Mutation 'R8142:Stau2'
ID632565
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score212.009
Status Not validated
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16460351 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000111016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000115359] [ENSMUST00000127420] [ENSMUST00000128957] [ENSMUST00000131257] [ENSMUST00000144138] [ENSMUST00000145092] [ENSMUST00000149320] [ENSMUST00000151888] [ENSMUST00000153966] [ENSMUST00000159558] [ENSMUST00000162007] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect probably benign
Transcript: ENSMUST00000027052
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000054668
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000115359
AA Change: S115P
SMART Domains Protein: ENSMUSP00000111016
Gene: ENSMUSG00000025920
AA Change: S115P

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127420
SMART Domains Protein: ENSMUSP00000122116
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-4 SMART
Blast:DSRM 5 42 9e-17 BLAST
Blast:DSRM 64 110 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128957
SMART Domains Protein: ENSMUSP00000122410
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000131257
SMART Domains Protein: ENSMUSP00000121410
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 1 34 9e-3 SMART
DSRM 58 142 2.36e-7 SMART
DSRM 170 235 1.84e-18 SMART
DSRM 270 336 5.45e-21 SMART
low complexity region 409 427 N/A INTRINSIC
PDB:4DKK|A 428 473 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000144138
AA Change: S115P
SMART Domains Protein: ENSMUSP00000119130
Gene: ENSMUSG00000025920
AA Change: S115P

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145092
AA Change: S83P
SMART Domains Protein: ENSMUSP00000115041
Gene: ENSMUSG00000025920
AA Change: S83P

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 1e-4 SMART
Blast:DSRM 5 42 1e-16 BLAST
low complexity region 44 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149320
SMART Domains Protein: ENSMUSP00000118489
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151888
SMART Domains Protein: ENSMUSP00000125473
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
Blast:DSRM 1 55 3e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153966
SMART Domains Protein: ENSMUSP00000117537
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159558
SMART Domains Protein: ENSMUSP00000125726
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162007
SMART Domains Protein: ENSMUSP00000124303
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162435
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162627
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162751
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0124:Stau2 UTSW 1 16463128 missense probably damaging 1.00
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1104:Stau2 UTSW 1 16440361 nonsense probably null
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R2884:Stau2 UTSW 1 16231066 missense possibly damaging 0.81
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 splice site probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R6964:Stau2 UTSW 1 16390005 missense probably damaging 1.00
R7317:Stau2 UTSW 1 16460329 missense unknown
R7885:Stau2 UTSW 1 16460353 missense unknown
R8161:Stau2 UTSW 1 16345825 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGCTACTAGGGTGCACCAG -3'
(R):5'- AGTGCACACATTACTGTTGCC -3'

Sequencing Primer
(F):5'- GCAGTACTGATGATCCTAGGTTCAC -3'
(R):5'- TTGCCAAGCTGAATAGGCTC -3'
Posted On2020-06-30