Incidental Mutation 'R8142:Bmpr2'
ID632566
Institutional Source Beutler Lab
Gene Symbol Bmpr2
Ensembl Gene ENSMUSG00000067336
Gene Namebone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms2610024H22Rik, BMPRII, BMPR-II, BMP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location59763400-59879014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59870306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 980 (S980P)
Ref Sequence ENSEMBL: ENSMUSP00000084701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087435]
Predicted Effect probably damaging
Transcript: ENSMUST00000087435
AA Change: S980P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084701
Gene: ENSMUSG00000067336
AA Change: S980P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 33 131 6.9e-17 PFAM
low complexity region 132 142 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Pfam:Pkinase 203 501 6.6e-33 PFAM
Pfam:Pkinase_Tyr 203 501 1.3e-29 PFAM
low complexity region 545 558 N/A INTRINSIC
low complexity region 603 628 N/A INTRINSIC
low complexity region 694 710 N/A INTRINSIC
low complexity region 901 908 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type II receptor that binds extracellular BMPs and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important during embryonic development. Mutations in this gene can cause pulmonary hypertension. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mutants arrest at the egg cylinder stage and die before embryonic day 9.5 with failure to form organized structure and lacking mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Bmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Bmpr2 APN 1 59815315 missense possibly damaging 0.88
IGL01366:Bmpr2 APN 1 59813677 missense probably damaging 1.00
IGL02281:Bmpr2 APN 1 59868344 missense probably damaging 1.00
IGL02531:Bmpr2 APN 1 59845714 splice site probably null
IGL03114:Bmpr2 APN 1 59867444 missense probably damaging 1.00
R0114:Bmpr2 UTSW 1 59815340 missense probably damaging 1.00
R0145:Bmpr2 UTSW 1 59867580 frame shift probably null
R0423:Bmpr2 UTSW 1 59868510 missense probably benign
R0480:Bmpr2 UTSW 1 59845659 missense probably damaging 1.00
R0556:Bmpr2 UTSW 1 59815328 missense probably damaging 1.00
R0597:Bmpr2 UTSW 1 59841425 splice site probably benign
R1167:Bmpr2 UTSW 1 59859304 missense probably damaging 1.00
R1537:Bmpr2 UTSW 1 59868126 missense probably benign 0.31
R1769:Bmpr2 UTSW 1 59868361 missense probably damaging 1.00
R1946:Bmpr2 UTSW 1 59868397 missense possibly damaging 0.83
R1972:Bmpr2 UTSW 1 59813603 missense possibly damaging 0.55
R4524:Bmpr2 UTSW 1 59867412 missense probably benign 0.00
R4558:Bmpr2 UTSW 1 59845692 missense probably damaging 0.99
R4667:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4668:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4669:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4868:Bmpr2 UTSW 1 59870456 missense probably benign 0.03
R4922:Bmpr2 UTSW 1 59867424 missense probably benign
R5015:Bmpr2 UTSW 1 59851224 missense probably damaging 1.00
R5421:Bmpr2 UTSW 1 59870418 missense possibly damaging 0.96
R5808:Bmpr2 UTSW 1 59867401 missense probably benign 0.09
R6057:Bmpr2 UTSW 1 59842818 missense probably benign 0.00
R6228:Bmpr2 UTSW 1 59867436 missense probably benign 0.11
R6449:Bmpr2 UTSW 1 59867437 missense probably damaging 0.99
R6475:Bmpr2 UTSW 1 59868344 missense probably damaging 1.00
R6754:Bmpr2 UTSW 1 59870280 missense probably damaging 1.00
R7080:Bmpr2 UTSW 1 59867683 missense probably benign 0.00
R7410:Bmpr2 UTSW 1 59868493 missense probably benign
R7425:Bmpr2 UTSW 1 59867351 missense probably benign 0.12
R8027:Bmpr2 UTSW 1 59867803 missense probably damaging 1.00
R8032:Bmpr2 UTSW 1 59867343 missense probably benign 0.03
R8117:Bmpr2 UTSW 1 59847093 missense probably damaging 0.99
R8166:Bmpr2 UTSW 1 59867581 missense probably damaging 0.98
R8376:Bmpr2 UTSW 1 59867356 missense probably damaging 0.99
R8419:Bmpr2 UTSW 1 59867356 missense probably damaging 0.99
Z1176:Bmpr2 UTSW 1 59847167 missense not run
Z1177:Bmpr2 UTSW 1 59847167 missense not run
Predicted Primers PCR Primer
(F):5'- GACCTGTTTGTGAAATTTAGCCC -3'
(R):5'- TGCTGACAGGAGGTTAAAGC -3'

Sequencing Primer
(F):5'- AGGAGCATCTTGAGCCTTGATCC -3'
(R):5'- GTCTTCTGCATGTTTAAATGATGC -3'
Posted On2020-06-30