Incidental Mutation 'R8142:Ngef'
ID632568
Institutional Source Beutler Lab
Gene Symbol Ngef
Ensembl Gene ENSMUSG00000026259
Gene Nameneuronal guanine nucleotide exchange factor
SynonymsTims2, ephexin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87476834-87573870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 87540741 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 99 (R99G)
Ref Sequence ENSEMBL: ENSMUSP00000066894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068681] [ENSMUST00000166055]
Predicted Effect probably benign
Transcript: ENSMUST00000068681
AA Change: R99G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066894
Gene: ENSMUSG00000026259
AA Change: R99G

DomainStartEndE-ValueType
low complexity region 213 226 N/A INTRINSIC
RhoGEF 277 456 8.16e-46 SMART
PH 490 603 1.2e-7 SMART
SH3 615 672 8.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166055
SMART Domains Protein: ENSMUSP00000132099
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
Pfam:BNR_2 32 110 8e-11 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no overt axonal phenotype; however, cultured retinal ganglion cells display defects in axonal outgrowth and ephrin-induced growth cone collapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Ngef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Ngef APN 1 87540696 missense probably benign 0.06
IGL02475:Ngef APN 1 87479150 missense possibly damaging 0.79
IGL02478:Ngef APN 1 87480579 splice site probably benign
IGL03002:Ngef APN 1 87509392 splice site probably null
H8562:Ngef UTSW 1 87487807 missense possibly damaging 0.84
R0078:Ngef UTSW 1 87540665 missense probably benign 0.12
R0145:Ngef UTSW 1 87540648 intron probably benign
R0193:Ngef UTSW 1 87509334 missense probably benign 0.03
R0244:Ngef UTSW 1 87487962 unclassified probably benign
R0486:Ngef UTSW 1 87479126 missense probably damaging 1.00
R0865:Ngef UTSW 1 87484601 missense probably benign
R1824:Ngef UTSW 1 87503264 critical splice donor site probably null
R1994:Ngef UTSW 1 87487904 missense probably damaging 1.00
R2020:Ngef UTSW 1 87545968 missense probably benign 0.43
R4059:Ngef UTSW 1 87486231 missense probably damaging 0.99
R4770:Ngef UTSW 1 87477561 missense probably damaging 1.00
R4959:Ngef UTSW 1 87503348 missense possibly damaging 0.68
R5197:Ngef UTSW 1 87509368 nonsense probably null
R5286:Ngef UTSW 1 87545830 missense probably benign
R5293:Ngef UTSW 1 87503429 small deletion probably benign
R6065:Ngef UTSW 1 87477648 missense probably damaging 1.00
R6192:Ngef UTSW 1 87487900 missense probably damaging 0.98
R6925:Ngef UTSW 1 87503263 splice site probably null
R7176:Ngef UTSW 1 87480695 missense possibly damaging 0.94
R7437:Ngef UTSW 1 87480605 missense probably damaging 0.98
R7760:Ngef UTSW 1 87540773 missense probably benign 0.00
R8058:Ngef UTSW 1 87546022 nonsense probably null
R8154:Ngef UTSW 1 87540760 missense probably benign
Z1177:Ngef UTSW 1 87482709 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGACTAAATGACAAGTGACATCCTG -3'
(R):5'- TTATCAGCTCCATTGCAGTGAC -3'

Sequencing Primer
(F):5'- GACAAGTGACATCCTGTATCTCTGAG -3'
(R):5'- ATTGCAGTGACATCCCAGGTC -3'
Posted On2020-06-30