Incidental Mutation 'R8142:Per2'
ID632569
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Nameperiod circadian clock 2
SynonymsmPer2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8142 (G1)
Quality Score170.009
Status Not validated
Chromosome1
Chromosomal Location91415982-91459324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91421547 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1034 (E1034G)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069620
AA Change: E1034G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: E1034G

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2893:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R3109:Per2 UTSW 1 91445575 missense probably benign 0.02
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6702:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
R8261:Per2 UTSW 1 91433448 missense possibly damaging 0.87
R8277:Per2 UTSW 1 91420552 missense probably benign 0.15
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGGCTACCATACAGCTGTG -3'
(R):5'- CCACAAAATCTGCCTGCCTG -3'

Sequencing Primer
(F):5'- ACCATACAGCTGTGTCCTCAG -3'
(R):5'- CTGACAGACAGGTAAAGGAAAGGC -3'
Posted On2020-06-30