Incidental Mutation 'R8142:Zbtb34'
ID632570
Institutional Source Beutler Lab
Gene Symbol Zbtb34
Ensembl Gene ENSMUSG00000068966
Gene Namezinc finger and BTB domain containing 34
SynonymsLOC241311
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R8142 (G1)
Quality Score201.009
Status Not validated
Chromosome2
Chromosomal Location33406108-33431324 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33412481 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 16 (S16*)
Ref Sequence ENSEMBL: ENSMUSP00000088560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091037] [ENSMUST00000113158]
Predicted Effect probably null
Transcript: ENSMUST00000091037
AA Change: S16*
SMART Domains Protein: ENSMUSP00000088560
Gene: ENSMUSG00000068966
AA Change: S16*

DomainStartEndE-ValueType
BTB 50 144 1.28e-22 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 390 412 1.06e-4 SMART
ZnF_C2H2 418 440 1.12e-3 SMART
ZnF_C2H2 446 469 1.69e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113158
AA Change: S16*
SMART Domains Protein: ENSMUSP00000108783
Gene: ENSMUSG00000068966
AA Change: S16*

DomainStartEndE-ValueType
BTB 50 144 1.28e-22 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 390 412 1.06e-4 SMART
ZnF_C2H2 418 440 1.12e-3 SMART
ZnF_C2H2 446 469 1.69e-3 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Zbtb34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02721:Zbtb34 APN 2 33411258 missense probably damaging 1.00
R0398:Zbtb34 UTSW 2 33411048 nonsense probably null
R1767:Zbtb34 UTSW 2 33411336 missense possibly damaging 0.95
R4973:Zbtb34 UTSW 2 33411614 missense probably benign 0.28
R5150:Zbtb34 UTSW 2 33411121 missense probably damaging 1.00
R6063:Zbtb34 UTSW 2 33411830 missense possibly damaging 0.75
R6489:Zbtb34 UTSW 2 33411546 missense probably damaging 1.00
R6525:Zbtb34 UTSW 2 33412133 missense probably damaging 0.97
R7973:Zbtb34 UTSW 2 33411519 missense probably benign
Z1088:Zbtb34 UTSW 2 33411108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGAATGGTCCCGGAAATAC -3'
(R):5'- TGATGCTGGGCCAATGGATC -3'

Sequencing Primer
(F):5'- AATACGGGGAGCTGGCTGC -3'
(R):5'- TGGGCCAATGGATCATTCAC -3'
Posted On2020-06-30