Incidental Mutation 'R8142:Epha10'
ID632576
Institutional Source Beutler Lab
Gene Symbol Epha10
Ensembl Gene ENSMUSG00000028876
Gene NameEph receptor A10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location124880899-124917800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124885846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 162 (T162A)
Ref Sequence ENSEMBL: ENSMUSP00000050810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059343]
Predicted Effect probably damaging
Transcript: ENSMUST00000059343
AA Change: T162A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050810
Gene: ENSMUSG00000028876
AA Change: T162A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EPH_lbd 35 211 2.5e-109 SMART
low complexity region 219 232 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118801
Gene: ENSMUSG00000028876
AA Change: T16A

DomainStartEndE-ValueType
Pfam:Ephrin_lbd 1 66 2.2e-25 PFAM
low complexity region 74 87 N/A INTRINSIC
FN3 193 290 6.54e-6 SMART
FN3 306 392 1.66e-7 SMART
Pfam:EphA2_TM 421 496 2.4e-15 PFAM
TyrKc 499 754 5.17e-90 SMART
SAM 784 851 1.2e-15 SMART
low complexity region 852 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors, the largest subfamily of receptor tyrosine kinases (RTKs), and their ephrin ligands are important mediators of cell-cell communication regulating cell attachment, shape, and mobility in neuronal and epithelial cells (Aasheim et al., 2005 [PubMed 15777695]). See MIM 179610 for additional background on Eph receptors and ephrins.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Epha10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01969:Epha10 APN 4 124885877 missense probably damaging 1.00
R1319:Epha10 UTSW 4 124881914 missense probably benign
R1544:Epha10 UTSW 4 124885596 missense probably damaging 1.00
R4504:Epha10 UTSW 4 124915687 unclassified probably benign
R4505:Epha10 UTSW 4 124915687 unclassified probably benign
R4507:Epha10 UTSW 4 124915687 unclassified probably benign
R4572:Epha10 UTSW 4 124902568 missense unknown
R4605:Epha10 UTSW 4 124885757 missense probably damaging 1.00
R4818:Epha10 UTSW 4 124886214 critical splice donor site probably null
R5037:Epha10 UTSW 4 124915385 unclassified probably benign
R5281:Epha10 UTSW 4 124913988 unclassified probably benign
R5319:Epha10 UTSW 4 124914000 unclassified probably benign
R5322:Epha10 UTSW 4 124885748 missense probably damaging 1.00
R5400:Epha10 UTSW 4 124914121 unclassified probably benign
R5681:Epha10 UTSW 4 124902566 missense unknown
R5694:Epha10 UTSW 4 124902653 missense unknown
R6813:Epha10 UTSW 4 124902693 missense
R7471:Epha10 UTSW 4 124902572 missense
R7699:Epha10 UTSW 4 124902647 missense
R7732:Epha10 UTSW 4 124915299 missense
R7735:Epha10 UTSW 4 124913679 missense
R7793:Epha10 UTSW 4 124914453 missense probably benign 0.00
R7899:Epha10 UTSW 4 124914835 missense
R8057:Epha10 UTSW 4 124902683 missense
X0026:Epha10 UTSW 4 124885547 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124883942 missense probably damaging 1.00
Z1176:Epha10 UTSW 4 124885775 missense probably damaging 1.00
Z1177:Epha10 UTSW 4 124881960 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCGTGGAGCTGCAGTTCAC -3'
(R):5'- TTCCTGGAATCCTGCACTG -3'

Sequencing Primer
(F):5'- AGTTCACACTGCGCGACTG -3'
(R):5'- AGAAGGCGCTCTCAGCTG -3'
Posted On2020-06-30