Incidental Mutation 'R8142:Uncx'
ID632580
Institutional Source Beutler Lab
Gene Symbol Uncx
Ensembl Gene ENSMUSG00000029546
Gene NameUNC homeobox
SynonymsChx4, Uncx4.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score191.009
Status Not validated
Chromosome5
Chromosomal Location139543494-139548179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139546900 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000134067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172997] [ENSMUST00000174792]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172997
AA Change: D240G

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134067
Gene: ENSMUSG00000029546
AA Change: D240G

DomainStartEndE-ValueType
low complexity region 8 13 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
low complexity region 110 138 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 184 207 N/A INTRINSIC
low complexity region 215 233 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174792
SMART Domains Protein: ENSMUSP00000139081
Gene: ENSMUSG00000029546

DomainStartEndE-ValueType
HOX 109 164 1.9e-10 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit severe skeletal defects, including absence of pedicles, transverse processes and proximal ribs. Mutants die around birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Uncx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Uncx APN 5 139546768 missense possibly damaging 0.95
PIT4378001:Uncx UTSW 5 139544622 nonsense probably null
R0658:Uncx UTSW 5 139544187 missense probably damaging 0.99
R0959:Uncx UTSW 5 139546687 missense probably damaging 1.00
R1786:Uncx UTSW 5 139547547 missense probably benign 0.00
R3870:Uncx UTSW 5 139547365 missense probably damaging 0.98
R4022:Uncx UTSW 5 139546689 missense probably damaging 0.97
R4512:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4514:Uncx UTSW 5 139546767 missense possibly damaging 0.59
R4604:Uncx UTSW 5 139544082 missense possibly damaging 0.95
R4864:Uncx UTSW 5 139544120 missense probably damaging 0.98
R5048:Uncx UTSW 5 139547119 missense probably benign 0.00
R5408:Uncx UTSW 5 139544490 nonsense probably null
R5954:Uncx UTSW 5 139547629 missense probably benign
R5997:Uncx UTSW 5 139547589 missense probably damaging 1.00
R7477:Uncx UTSW 5 139547262 missense probably benign
R7563:Uncx UTSW 5 139544506 missense probably damaging 1.00
R7598:Uncx UTSW 5 139544054 missense probably benign 0.09
R8347:Uncx UTSW 5 139546816 missense probably damaging 0.99
Z1176:Uncx UTSW 5 139544154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATCGCCGGGCCAAATG -3'
(R):5'- AGAGCAAGAAGTGGCCCTTG -3'

Sequencing Primer
(F):5'- CCAAAAAGGGCCCTGGC -3'
(R):5'- TTGCCAATCAGGGTCCGAG -3'
Posted On2020-06-30