Incidental Mutation 'R8142:Gm15922'
ID632583
Institutional Source Beutler Lab
Gene Symbol Gm15922
Ensembl Gene ENSMUSG00000081665
Gene Namepredicted gene 15922
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R8142 (G1)
Quality Score151.01
Status Not validated
Chromosome7
Chromosomal Location3733021-3739861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3736843 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 418 (S418P)
Ref Sequence ENSEMBL: ENSMUSP00000145713 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000118068
AA Change: S418P

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Gm15922
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Gm15922 UTSW 7 3739640 missense possibly damaging 0.82
R3902:Gm15922 UTSW 7 3737277 missense probably damaging 0.99
R4246:Gm15922 UTSW 7 3737349 missense probably damaging 1.00
R5125:Gm15922 UTSW 7 3739397 nonsense probably null
R5178:Gm15922 UTSW 7 3739397 nonsense probably null
R5388:Gm15922 UTSW 7 3738857 missense possibly damaging 0.49
R5471:Gm15922 UTSW 7 3735515 missense probably benign 0.02
R5985:Gm15922 UTSW 7 3737317 missense probably damaging 1.00
R6248:Gm15922 UTSW 7 3736338 missense probably benign
R6360:Gm15922 UTSW 7 3736504 missense probably damaging 1.00
R6451:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6453:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6454:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6455:Gm15922 UTSW 7 3738931 missense probably benign 0.00
R6594:Gm15922 UTSW 7 3736499 nonsense probably null
R6654:Gm15922 UTSW 7 3735929 missense probably benign 0.19
R6813:Gm15922 UTSW 7 3736003 missense probably benign 0.03
R6972:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6975:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7069:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7072:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7188:Gm15922 UTSW 7 3738829 missense probably damaging 0.99
R7304:Gm15922 UTSW 7 3737494 missense probably damaging 1.00
R7329:Gm15922 UTSW 7 3739876 start gained probably benign
R7404:Gm15922 UTSW 7 3739345 missense probably damaging 1.00
R7454:Gm15922 UTSW 7 3735510 missense probably benign 0.03
R7493:Gm15922 UTSW 7 3739024 missense not run
R7655:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7656:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7953:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7956:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7957:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8037:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8038:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8043:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8096:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8117:Gm15922 UTSW 7 3737076 missense probably damaging 1.00
R8128:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8134:Gm15922 UTSW 7 3735839 missense probably damaging 0.99
R8311:Gm15922 UTSW 7 3736483 missense probably benign 0.42
R8511:Gm15922 UTSW 7 3739348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGAGAGGGCTTCTTG -3'
(R):5'- GTGCCTCAGACTTTCACTACG -3'

Sequencing Primer
(F):5'- TTCTTGGACAGCCCTAGAGG -3'
(R):5'- CGATAAATTCATTCTCACCAAGGAAG -3'
Posted On2020-06-30