Incidental Mutation 'R8142:Cyp2f2'
ID632585
Institutional Source Beutler Lab
Gene Symbol Cyp2f2
Ensembl Gene ENSMUSG00000052974
Gene Namecytochrome P450, family 2, subfamily f, polypeptide 2
SynonymsCyp2f
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27119909-27133660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27129253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 183 (V183I)
Ref Sequence ENSEMBL: ENSMUSP00000003100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003100] [ENSMUST00000206552]
Predicted Effect probably benign
Transcript: ENSMUST00000003100
AA Change: V183I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003100
Gene: ENSMUSG00000052974
AA Change: V183I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:p450 31 488 3.7e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206552
AA Change: V107I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to napthalene-induced toxicity in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Cyp2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Cyp2f2 APN 7 27121929 missense probably damaging 0.98
IGL00953:Cyp2f2 APN 7 27129817 missense possibly damaging 0.47
IGL01781:Cyp2f2 APN 7 27130421 missense probably benign 0.20
IGL02817:Cyp2f2 APN 7 27129315 missense probably damaging 1.00
IGL03027:Cyp2f2 APN 7 27132571 missense possibly damaging 0.95
R0464:Cyp2f2 UTSW 7 27132537 missense probably benign 0.00
R1481:Cyp2f2 UTSW 7 27121877 missense probably benign 0.00
R1635:Cyp2f2 UTSW 7 27129724 missense probably benign 0.11
R1826:Cyp2f2 UTSW 7 27132562 missense probably damaging 1.00
R1989:Cyp2f2 UTSW 7 27129203 missense probably damaging 1.00
R5098:Cyp2f2 UTSW 7 27129879 missense possibly damaging 0.52
R6305:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R6472:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R7132:Cyp2f2 UTSW 7 27132568 missense probably benign 0.00
R7599:Cyp2f2 UTSW 7 27131359 critical splice donor site probably null
R7814:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7823:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7824:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7825:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8141:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R8143:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
X0064:Cyp2f2 UTSW 7 27133284 missense probably damaging 1.00
Z1177:Cyp2f2 UTSW 7 27121907 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAGCATTCTGGACTGTGAGG -3'
(R):5'- ATGGGTGGACCGTGTAACTG -3'

Sequencing Primer
(F):5'- AGGTGCTGTCTCACGGTG -3'
(R):5'- TCAGGAACTTGTGGCAATCC -3'
Posted On2020-06-30