Incidental Mutation 'R8142:Pdzd3'
ID632588
Institutional Source Beutler Lab
Gene Symbol Pdzd3
Ensembl Gene ENSMUSG00000032105
Gene NamePDZ domain containing 3
Synonymssodium-phosphate cotransporter IIa C-terminal-associated protein 2, Pdzk2, NaPi-Cap2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44247307-44251471 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44250781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000092426] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213891] [ENSMUST00000215554] [ENSMUST00000215711] [ENSMUST00000216632] [ENSMUST00000217510]
Predicted Effect probably null
Transcript: ENSMUST00000034618
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092426
SMART Domains Protein: ENSMUSP00000090082
Gene: ENSMUSG00000070306

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
coiled coil region 26 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213891
Predicted Effect probably benign
Transcript: ENSMUST00000215554
Predicted Effect probably benign
Transcript: ENSMUST00000215711
Predicted Effect probably benign
Transcript: ENSMUST00000216632
Predicted Effect probably benign
Transcript: ENSMUST00000217510
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Pdzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Pdzd3 APN 9 44249636 missense possibly damaging 0.84
IGL01639:Pdzd3 APN 9 44248679 missense probably benign 0.41
IGL02210:Pdzd3 APN 9 44248317 missense probably benign
IGL02502:Pdzd3 APN 9 44249651 missense probably benign
IGL03082:Pdzd3 APN 9 44250786 missense possibly damaging 0.65
R0543:Pdzd3 UTSW 9 44248934 missense probably damaging 1.00
R1180:Pdzd3 UTSW 9 44249246 missense probably benign 0.38
R1919:Pdzd3 UTSW 9 44250303 missense possibly damaging 0.83
R4019:Pdzd3 UTSW 9 44250820 unclassified probably null
R4020:Pdzd3 UTSW 9 44250820 unclassified probably null
R4296:Pdzd3 UTSW 9 44248861 missense probably benign 0.01
R4430:Pdzd3 UTSW 9 44249744 missense probably benign
R4433:Pdzd3 UTSW 9 44247988 makesense probably null
R4567:Pdzd3 UTSW 9 44249026 missense possibly damaging 0.90
R4942:Pdzd3 UTSW 9 44248618 nonsense probably null
R5436:Pdzd3 UTSW 9 44248355 missense possibly damaging 0.79
R6320:Pdzd3 UTSW 9 44248683 missense probably benign 0.00
R6688:Pdzd3 UTSW 9 44248230 critical splice donor site probably null
R7625:Pdzd3 UTSW 9 44250297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAATGAACTCTGCGTGG -3'
(R):5'- TTAACTCTGTAAGTAGTCTGAGGGC -3'

Sequencing Primer
(F):5'- AACTCTGCGTGGGCTGG -3'
(R):5'- TAAGTAGTCTGAGGGCTGGAG -3'
Posted On2020-06-30