Incidental Mutation 'R8142:Vps11'
ID632589
Institutional Source Beutler Lab
Gene Symbol Vps11
Ensembl Gene ENSMUSG00000032127
Gene NameVPS11, CORVET/HOPS core subunit
Synonyms1200011A11Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_027889.1; MGI:1918982

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44347749-44361670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44354555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 476 (T476A)
Ref Sequence ENSEMBL: ENSMUSP00000034644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034644] [ENSMUST00000213249] [ENSMUST00000213740] [ENSMUST00000214510]
Predicted Effect probably benign
Transcript: ENSMUST00000034644
AA Change: T476A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034644
Gene: ENSMUSG00000032127
AA Change: T476A

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
SCOP:d1erja_ 59 292 3e-10 SMART
Blast:WD40 73 117 2e-22 BLAST
Blast:WD40 125 168 9e-24 BLAST
Blast:WD40 175 214 6e-16 BLAST
Blast:WD40 219 259 2e-20 BLAST
Pfam:Clathrin 412 548 2.7e-16 PFAM
coiled coil region 775 813 N/A INTRINSIC
RING 822 860 6.14e-5 SMART
Pfam:VPS11_C 862 908 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213249
Predicted Effect probably benign
Transcript: ENSMUST00000213740
Predicted Effect probably benign
Transcript: ENSMUST00000214460
Predicted Effect probably benign
Transcript: ENSMUST00000214510
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Vps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Vps11 APN 9 44356219 splice site probably benign
IGL03135:Vps11 APN 9 44356356 missense probably benign 0.39
PIT4696001:Vps11 UTSW 9 44358189 missense possibly damaging 0.89
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0122:Vps11 UTSW 9 44354512 missense probably damaging 1.00
R0335:Vps11 UTSW 9 44353838 missense probably null 0.02
R0714:Vps11 UTSW 9 44359656 missense possibly damaging 0.90
R1068:Vps11 UTSW 9 44353019 missense probably damaging 1.00
R1873:Vps11 UTSW 9 44359936 missense probably damaging 1.00
R1991:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2068:Vps11 UTSW 9 44358316 missense probably damaging 0.99
R2084:Vps11 UTSW 9 44353261 missense probably benign 0.14
R2103:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2119:Vps11 UTSW 9 44348997 missense probably benign 0.01
R4160:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4161:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4564:Vps11 UTSW 9 44361597 missense probably damaging 1.00
R4879:Vps11 UTSW 9 44353300 missense probably benign
R5629:Vps11 UTSW 9 44356376 missense probably damaging 1.00
R5910:Vps11 UTSW 9 44359135 splice site probably null
R5988:Vps11 UTSW 9 44353924 missense probably benign 0.01
R6430:Vps11 UTSW 9 44361550 missense probably benign 0.11
R7002:Vps11 UTSW 9 44355079 missense probably damaging 1.00
R7147:Vps11 UTSW 9 44355082 nonsense probably null
R7237:Vps11 UTSW 9 44354506 missense probably damaging 1.00
R7261:Vps11 UTSW 9 44354503 missense probably damaging 1.00
R7577:Vps11 UTSW 9 44348961 missense probably benign 0.01
R8093:Vps11 UTSW 9 44356232 missense probably damaging 1.00
R8238:Vps11 UTSW 9 44352760 missense probably benign 0.08
R8366:Vps11 UTSW 9 44355755 nonsense probably null
R8374:Vps11 UTSW 9 44356409 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTGTCTTCAAAGTGGCATTC -3'
(R):5'- CCCGAGTCCCTAGAAATGTCTTC -3'

Sequencing Primer
(F):5'- GTGCATGATTCTCAGCCA -3'
(R):5'- GAGTCCCTAGAAATGTCTTCCTAGTG -3'
Posted On2020-06-30