Incidental Mutation 'R8142:Npepps'
ID632595
Institutional Source Beutler Lab
Gene Symbol Npepps
Ensembl Gene ENSMUSG00000001441
Gene Nameaminopeptidase puromycin sensitive
SynonymsMP100, Psa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97205842-97280638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97218572 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 726 (A726D)
Ref Sequence ENSEMBL: ENSMUSP00000001480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001480] [ENSMUST00000167806] [ENSMUST00000172108]
Predicted Effect probably damaging
Transcript: ENSMUST00000001480
AA Change: A726D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001480
Gene: ENSMUSG00000001441
AA Change: A726D

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 5.2e-155 PFAM
Pfam:ERAP1_C 579 892 7.9e-72 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000128169
Gene: ENSMUSG00000001441
AA Change: A681D

DomainStartEndE-ValueType
low complexity region 4 35 N/A INTRINSIC
Pfam:Peptidase_M1 46 183 1.6e-28 PFAM
Pfam:Peptidase_M1 174 398 2.9e-100 PFAM
Pfam:ERAP1_C 535 848 2.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167806
SMART Domains Protein: ENSMUSP00000130445
Gene: ENSMUSG00000001441

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 3e-153 PFAM
Pfam:Peptidase_MA_2 321 465 7.4e-24 PFAM
Pfam:ERAP1_C 579 632 5.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172108
AA Change: A726D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127801
Gene: ENSMUSG00000001441
AA Change: A726D

DomainStartEndE-ValueType
low complexity region 3 45 N/A INTRINSIC
Pfam:Peptidase_M1 54 442 6e-153 PFAM
Pfam:Peptidase_MA_2 321 465 1.2e-23 PFAM
Pfam:ERAP1_C 579 859 5.7e-55 PFAM
low complexity region 868 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the puromycin-sensitive aminopeptidase, a zinc metallopeptidase which hydrolyzes amino acids from the N-terminus of its substrate. The protein has been localized to both the cytoplasm and to cellular membranes. This enzyme degrades enkaphalins in the brain, and studies in mouse suggest that it is involved in proteolytic events regulating the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene-trapped mutation exhibit dwarfism, increased anxiety, decreased pain sensitivity, and infertility in both sexes. Females fail to produce the corpus luteum of pregnancy, while males fail to copulate and have impaired spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Npepps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Npepps APN 11 97236058 splice site probably benign
IGL00904:Npepps APN 11 97258306 missense probably damaging 0.99
IGL00925:Npepps APN 11 97280283 missense probably damaging 0.97
IGL01074:Npepps APN 11 97217811 missense probably damaging 0.98
IGL01869:Npepps APN 11 97236122 missense probably damaging 1.00
IGL01879:Npepps APN 11 97258340 missense possibly damaging 0.66
IGL02145:Npepps APN 11 97218502 splice site probably null
IGL02493:Npepps APN 11 97238159 missense probably damaging 1.00
IGL02561:Npepps APN 11 97229849 nonsense probably null
IGL02957:Npepps APN 11 97242652 missense probably damaging 1.00
IGL03008:Npepps APN 11 97238158 missense probably damaging 1.00
disadvantaged UTSW 11 97258273 critical splice donor site probably null
Underprivileged UTSW 11 97267644 nonsense probably null
IGL03054:Npepps UTSW 11 97241788 intron probably benign
R0280:Npepps UTSW 11 97241014 missense possibly damaging 0.90
R0743:Npepps UTSW 11 97206058 utr 3 prime probably benign
R0838:Npepps UTSW 11 97267692 splice site probably benign
R1449:Npepps UTSW 11 97207154 missense probably benign 0.01
R1478:Npepps UTSW 11 97226847 missense probably benign 0.03
R1502:Npepps UTSW 11 97218575 missense possibly damaging 0.79
R1726:Npepps UTSW 11 97224669 missense probably damaging 1.00
R2413:Npepps UTSW 11 97240966 missense probably damaging 1.00
R3619:Npepps UTSW 11 97248265 missense possibly damaging 0.90
R4620:Npepps UTSW 11 97238244 missense probably damaging 1.00
R4782:Npepps UTSW 11 97226826 missense probably damaging 1.00
R4810:Npepps UTSW 11 97240933 missense probably damaging 1.00
R4998:Npepps UTSW 11 97206107 intron probably benign
R5086:Npepps UTSW 11 97217799 missense probably benign 0.01
R5289:Npepps UTSW 11 97240927 critical splice donor site probably null
R5740:Npepps UTSW 11 97236068 missense possibly damaging 0.85
R6004:Npepps UTSW 11 97223124 missense probably benign 0.03
R6181:Npepps UTSW 11 97242004 missense probably damaging 0.98
R6213:Npepps UTSW 11 97241997 nonsense probably null
R6244:Npepps UTSW 11 97213790 missense probably damaging 1.00
R6318:Npepps UTSW 11 97218548 missense probably damaging 0.98
R6478:Npepps UTSW 11 97258273 critical splice donor site probably null
R6724:Npepps UTSW 11 97206002 utr 3 prime probably benign
R6890:Npepps UTSW 11 97267644 nonsense probably null
R7035:Npepps UTSW 11 97223139 missense probably damaging 0.99
R7426:Npepps UTSW 11 97213156 missense probably benign 0.19
R7749:Npepps UTSW 11 97267628 missense probably benign
R7819:Npepps UTSW 11 97248269 missense probably damaging 1.00
R7885:Npepps UTSW 11 97218648 missense probably damaging 1.00
R8176:Npepps UTSW 11 97236151 missense probably damaging 1.00
R8237:Npepps UTSW 11 97248200 critical splice donor site probably null
R8355:Npepps UTSW 11 97241974 missense probably damaging 1.00
R8360:Npepps UTSW 11 97229839 missense probably benign
R8455:Npepps UTSW 11 97241974 missense probably damaging 1.00
R8508:Npepps UTSW 11 97244426 critical splice donor site probably null
X0021:Npepps UTSW 11 97238120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGACAGGGTGTGAGTGTC -3'
(R):5'- AAGACCGTAGACTTGGTATCAC -3'

Sequencing Primer
(F):5'- CGGTTTTTAGGCCAATTTTAACTCAC -3'
(R):5'- GACCGTAGACTTGGTATCACAGTTAC -3'
Posted On2020-06-30