Mutagenetix > Incidental Mutation

Incidental Mutation 'R8142:Vmn2r88'

632602

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r88

Ensembl Gene

ENSMUSG00000000606

Gene Name

vomeronasal 2, receptor 88

Synonyms

V2r3, V2r13

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R8142 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51410819-51419527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51414107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 293 (I293V)

Ref Sequence

ENSEMBL: ENSMUSP00000125126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]

AlphaFold

L7N1W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022438
AA Change: I301V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: I301V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:ANF_receptor	76	457	8.3e-27	PFAM
Pfam:NCD3G	516	570	1.2e-18	PFAM
Pfam:7tm_3	603	838	1.9e-55	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: I293V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	30	408	3.2e-30	PFAM
Pfam:NCD3G	463	516	1.2e-19	PFAM
Pfam:7tm_3	546	785	3.7e-81	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162998

SMART Domains

Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

Domain	Start	End	E-Value	Type
Pfam:Takusan	35	115	2.2e-25	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606
AA Change: I268V

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	52	399	3.7e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228139
AA Change: I293V

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 99.7%
3x: 99.5%
10x: 98.0%
20x: 91.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1e2	A	T	17: 86,944,655	I105N	possibly damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bmpr2	T	C	1: 59,870,306	S980P	probably damaging	Het
Ccno	T	G	13: 112,988,955	L151R	probably damaging	Het
Cdh2	A	C	18: 16,601,734	I801S	probably benign	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Dab1	T	A	4: 104,678,724	V110D	probably damaging	Het
Dnah3	T	C	7: 120,060,966	T828A	probably benign	Het
Dnah5	G	T	15: 28,384,373	V3088L	probably benign	Het
Dtd2	T	A	12: 51,999,810	D82V	probably damaging	Het
Dusp5	T	C	19: 53,537,481	F185L	probably damaging	Het
Epha10	A	G	4: 124,885,846	T162A	probably damaging	Het
Fat4	A	T	3: 38,891,203	D1415V	probably damaging	Het
Fitm1	T	C	14: 55,575,790	Y37H	possibly damaging	Het
Flg2	G	T	3: 93,215,475	E1651*	probably null	Het
Gm15922	A	G	7: 3,736,843	S418P	possibly damaging	Het
Ifit3	G	T	19: 34,587,501	C149F	probably damaging	Het
Lepr	C	A	4: 101,765,419	H465Q	possibly damaging	Het
Ltn1	A	C	16: 87,381,641	S1567A	probably benign	Het
March1	T	C	8: 66,456,126	V166A	probably benign	Het
Marveld2	T	C	13: 100,600,940	H424R	possibly damaging	Het
Mypop	A	G	7: 19,001,126	T383A	unknown	Het
Ngef	G	C	1: 87,540,741	R99G	probably benign	Het
Npepps	G	T	11: 97,218,572	A726D	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,650	D9V	probably benign	Het
Pcdhgb4	A	G	18: 37,721,113	D187G	probably damaging	Het
Pdzd3	A	G	9: 44,250,781		probably null	Het
Per2	T	C	1: 91,421,547	E1034G	possibly damaging	Het
Pkhd1l1	G	A	15: 44,514,931	R1027H	probably benign	Het
Pon2	A	T	6: 5,266,239	V260D	probably benign	Het
Rnase13	A	G	14: 51,922,436	I82T	probably damaging	Het
Sbno1	A	G	5: 124,408,545	S194P	probably benign	Het
Serpinb6c	T	A	13: 33,880,113	I320L	probably benign	Het
Sh3rf3	C	T	10: 59,049,383	R363*	probably null	Het
Slc11a1	T	C	1: 74,385,259	F500L	probably benign	Het
Slc1a4	A	G	11: 20,307,890		probably null	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Sorcs2	T	C	5: 36,062,614	N362S	possibly damaging	Het
Stau2	A	G	1: 16,460,351	S115P	unknown	Het
Stk38l	A	G	6: 146,758,572	N34S	probably benign	Het
Tmem201	T	C	4: 149,718,657	T585A	probably benign	Het
Ttc6	A	T	12: 57,697,472	I1297F	possibly damaging	Het
Uncx	A	G	5: 139,546,900	D240G	possibly damaging	Het
Vps11	T	C	9: 44,354,555	T476A	probably benign	Het
Vrtn	T	C	12: 84,650,621	L715P	probably damaging	Het
Wdr72	T	G	9: 74,139,667	V65G	probably damaging	Het
Zbtb21	T	C	16: 97,951,475	E536G	probably damaging	Het
Zbtb34	G	T	2: 33,412,481	S16*	probably null	Het
Zfhx2	G	A	14: 55,073,438	L600F	possibly damaging	Het

Other mutations in Vmn2r88

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r88	APN	14	51413125	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413060	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413256	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51416802	missense	possibly damaging	0.59
IGL02308:Vmn2r88	APN	14	51417980	missense	possibly damaging	0.96
IGL02481:Vmn2r88	APN	14	51414154	missense	probably benign
IGL02483:Vmn2r88	APN	14	51414154	missense	probably benign
IGL03241:Vmn2r88	APN	14	51418373	missense	probably benign	0.03
R0052:Vmn2r88	UTSW	14	51418700	missense	possibly damaging	0.88
R0070:Vmn2r88	UTSW	14	51414140	missense	probably benign	0.08
R0799:Vmn2r88	UTSW	14	51414502	missense	possibly damaging	0.61
R0906:Vmn2r88	UTSW	14	51418209	missense	probably damaging	1.00
R1322:Vmn2r88	UTSW	14	51414108	missense	probably damaging	1.00
R1352:Vmn2r88	UTSW	14	51418550	missense	probably damaging	1.00
R1639:Vmn2r88	UTSW	14	51416787	missense	probably damaging	0.98
R1780:Vmn2r88	UTSW	14	51418572	missense	probably damaging	1.00
R1834:Vmn2r88	UTSW	14	51413030	splice site	probably benign
R1911:Vmn2r88	UTSW	14	51418214	missense	probably damaging	1.00
R2113:Vmn2r88	UTSW	14	51418194	missense	probably damaging	1.00
R2120:Vmn2r88	UTSW	14	51413208	missense	probably benign	0.00
R2126:Vmn2r88	UTSW	14	51413807	missense	probably benign	0.01
R2348:Vmn2r88	UTSW	14	51414004	missense	probably benign	0.00
R2881:Vmn2r88	UTSW	14	51418689	missense	probably damaging	0.97
R2884:Vmn2r88	UTSW	14	51413934	missense	probably damaging	1.00
R3081:Vmn2r88	UTSW	14	51418632	missense	probably damaging	0.99
R3933:Vmn2r88	UTSW	14	51413978	missense	probably benign	0.44
R3967:Vmn2r88	UTSW	14	51413190	missense	probably benign	0.06
R4091:Vmn2r88	UTSW	14	51415426	missense	probably damaging	1.00
R4378:Vmn2r88	UTSW	14	51413289	nonsense	probably null
R4397:Vmn2r88	UTSW	14	51417978	missense	probably damaging	1.00
R4418:Vmn2r88	UTSW	14	51418081	missense	probably damaging	1.00
R4609:Vmn2r88	UTSW	14	51418074	missense	probably damaging	0.98
R4647:Vmn2r88	UTSW	14	51418793	missense	probably benign	0.02
R4672:Vmn2r88	UTSW	14	51418155	missense	probably damaging	1.00
R4684:Vmn2r88	UTSW	14	51413334	missense	possibly damaging	0.95
R4686:Vmn2r88	UTSW	14	51413339	missense	probably benign	0.03
R4720:Vmn2r88	UTSW	14	51413245	missense	probably benign	0.01
R5046:Vmn2r88	UTSW	14	51413181	missense	probably benign	0.03
R5063:Vmn2r88	UTSW	14	51411146	missense	probably damaging	0.96
R5619:Vmn2r88	UTSW	14	51413910	missense	probably damaging	0.99
R5652:Vmn2r88	UTSW	14	51418572	missense	probably damaging	0.98
R6020:Vmn2r88	UTSW	14	51418149	nonsense	probably null
R6103:Vmn2r88	UTSW	14	51415369	missense	probably benign	0.17
R6674:Vmn2r88	UTSW	14	51414338	missense	probably benign	0.01
R6799:Vmn2r88	UTSW	14	51413969	missense	probably benign	0.05
R7089:Vmn2r88	UTSW	14	51418643	missense
R7104:Vmn2r88	UTSW	14	51413796	missense
R7265:Vmn2r88	UTSW	14	51418319	missense
R7316:Vmn2r88	UTSW	14	51414255	missense
R7552:Vmn2r88	UTSW	14	51410858	splice site	probably null
R7611:Vmn2r88	UTSW	14	51413997	missense
R7667:Vmn2r88	UTSW	14	51417989	missense
R7682:Vmn2r88	UTSW	14	51418449	missense
R7755:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7811:Vmn2r88	UTSW	14	51418703	missense
R7882:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7957:Vmn2r88	UTSW	14	51413132	missense
R7998:Vmn2r88	UTSW	14	51414108	missense
R8186:Vmn2r88	UTSW	14	51418700	missense
R8348:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8448:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8483:Vmn2r88	UTSW	14	51413073	missense	possibly damaging	0.48
R8783:Vmn2r88	UTSW	14	51414066	missense
R8859:Vmn2r88	UTSW	14	51418806	missense	probably damaging	0.97
R8916:Vmn2r88	UTSW	14	51411136	missense
R8936:Vmn2r88	UTSW	14	51418526	missense	possibly damaging	0.88
R9004:Vmn2r88	UTSW	14	51413167	missense
R9038:Vmn2r88	UTSW	14	51414033	missense
R9063:Vmn2r88	UTSW	14	51410872	start gained	probably benign
R9311:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R9382:Vmn2r88	UTSW	14	51418740	missense
R9483:Vmn2r88	UTSW	14	51411184	missense
R9602:Vmn2r88	UTSW	14	51413732	missense
V5622:Vmn2r88	UTSW	14	51413127	missense	probably benign
X0024:Vmn2r88	UTSW	14	51413832	missense	possibly damaging	0.79
X0025:Vmn2r88	UTSW	14	51416802	missense	possibly damaging	0.59
Z1177:Vmn2r88	UTSW	14	51418046	frame shift	probably null
Z1177:Vmn2r88	UTSW	14	51418187	missense
Z1190:Vmn2r88	UTSW	14	51413201	missense

Predicted Primers

PCR Primer
(F):5'- AAGGCATGGGATCTGTTTAGC -3'
(R):5'- GCTGTCCATTCCAATGTGTTG -3'

Sequencing Primer
(F):5'- AAGGCATGGGATCTGTTTAGCTTTTG -3'
(R):5'- CCATTCCAATGTGTTGTTGAATG -3'

Posted On

2020-06-30