Incidental Mutation 'R8142:Fitm1'
ID632605
Institutional Source Beutler Lab
Gene Symbol Fitm1
Ensembl Gene ENSMUSG00000022215
Gene Namefat storage-inducing transmembrane protein 1
SynonymsCg10671, Fit1, 1110028A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R8142 (G1)
Quality Score212.009
Status Not validated
Chromosome14
Chromosomal Location55575617-55576954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55575790 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 37 (Y37H)
Ref Sequence ENSEMBL: ENSMUSP00000022826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022826] [ENSMUST00000089619] [ENSMUST00000172738] [ENSMUST00000174259] [ENSMUST00000174484] [ENSMUST00000174563]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022826
AA Change: Y37H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022826
Gene: ENSMUSG00000022215
AA Change: Y37H

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089619
SMART Domains Protein: ENSMUSP00000087046
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.1e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 236 2.4e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172738
SMART Domains Protein: ENSMUSP00000133867
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 3.8e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 129 226 3.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174259
SMART Domains Protein: ENSMUSP00000134735
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 8 68 6e-27 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 103 247 9.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174419
Predicted Effect probably benign
Transcript: ENSMUST00000174484
SMART Domains Protein: ENSMUSP00000133883
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.4e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 238 7.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174563
SMART Domains Protein: ENSMUSP00000133366
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 58 7.5e-18 PFAM
low complexity region 59 87 N/A INTRINSIC
Pfam:PA28_beta 89 173 5.4e-37 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FIT1 belongs to an evolutionarily conserved family of proteins involved in fat storage (Kadereit et al., 2008 [PubMed 18160536]).[supplied by OMIM, May 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Fitm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0584:Fitm1 UTSW 14 55576656 missense probably benign 0.00
R4938:Fitm1 UTSW 14 55576619 missense probably damaging 1.00
R4959:Fitm1 UTSW 14 55576374 splice site probably null
R4997:Fitm1 UTSW 14 55576907 missense probably benign
R5071:Fitm1 UTSW 14 55575773 missense possibly damaging 0.50
R5548:Fitm1 UTSW 14 55575697 missense probably benign
R7400:Fitm1 UTSW 14 55576769 missense possibly damaging 0.62
R8084:Fitm1 UTSW 14 55576449 missense probably damaging 0.97
Z1177:Fitm1 UTSW 14 55576649 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTACCACACCTGTCACTG -3'
(R):5'- GCAGCTCCTATGGACTTCAGTG -3'

Sequencing Primer
(F):5'- CTGCCTATCCTTGTCTGAGGGAAG -3'
(R):5'- CTATGGACTTCAGTGGACTCACATG -3'
Posted On2020-06-30