Incidental Mutation 'R8142:Ltn1'
ID632608
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87381641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1567 (S1567A)
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449]
Predicted Effect probably benign
Transcript: ENSMUST00000039449
AA Change: S1567A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: S1567A

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 splice site probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
R7691:Ltn1 UTSW 16 87398686 missense probably damaging 0.99
R7702:Ltn1 UTSW 16 87426278 missense probably damaging 1.00
R7761:Ltn1 UTSW 16 87411793 missense probably benign
R8002:Ltn1 UTSW 16 87415947 missense probably benign 0.17
R8101:Ltn1 UTSW 16 87418497 missense probably damaging 1.00
R8214:Ltn1 UTSW 16 87380803 missense probably benign 0.02
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Z1177:Ltn1 UTSW 16 87402037 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGAGTAACACAGAGTAGTCAG -3'
(R):5'- TGGATGCTAACCCTCTTGGAG -3'

Sequencing Primer
(F):5'- ACCGTCATGCCATTGAATAGCTG -3'
(R):5'- AGGTGGGGGCCTTTCTC -3'
Posted On2020-06-30