Incidental Mutation 'R8142:Zbtb21'
ID632609
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Namezinc finger and BTB domain containing 21
SynonymsZfp295, B430213I24Rik, 5430437K12Rik, Znf295
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location97943357-97962622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97951475 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 536 (E536G)
Ref Sequence ENSEMBL: ENSMUSP00000068283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
Predicted Effect probably damaging
Transcript: ENSMUST00000052089
AA Change: E564G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962
AA Change: E564G

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063605
AA Change: E536G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: E536G

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113734
AA Change: E564G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: E564G

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231263
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97952320 missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97952022 missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97952689 missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97951790 missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97951745 missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97952333 missense possibly damaging 0.94
R0165:Zbtb21 UTSW 16 97951404 missense probably damaging 1.00
R0184:Zbtb21 UTSW 16 97950513 missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97952100 missense probably damaging 1.00
R0734:Zbtb21 UTSW 16 97952627 missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97952027 missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97952427 missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97950585 missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97950155 missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97952763 missense probably damaging 1.00
R4619:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4620:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97951266 missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97950455 missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97950498 missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97951499 missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97950368 missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97956772 missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97951082 missense probably damaging 0.97
R6830:Zbtb21 UTSW 16 97951961 missense probably damaging 1.00
R7123:Zbtb21 UTSW 16 97949912 missense probably damaging 0.96
R7129:Zbtb21 UTSW 16 97951687 small deletion probably benign
R7261:Zbtb21 UTSW 16 97952979 missense possibly damaging 0.46
R7305:Zbtb21 UTSW 16 97951295 missense possibly damaging 0.92
R7372:Zbtb21 UTSW 16 97950369 missense possibly damaging 0.55
R7564:Zbtb21 UTSW 16 97951540 nonsense probably null
R7670:Zbtb21 UTSW 16 97951877 missense probably damaging 0.99
R7788:Zbtb21 UTSW 16 97951454 missense possibly damaging 0.62
X0022:Zbtb21 UTSW 16 97952075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGGGAACTAGAGGCTG -3'
(R):5'- TGAGCAGACTCCCAGCAAAG -3'

Sequencing Primer
(F):5'- GGTCTGACAGTGTGTCCAC -3'
(R):5'- TCCCAGCAAAGAGAAGGTTC -3'
Posted On2020-06-30