Incidental Mutation 'R8142:Ifit3'
ID632613
Institutional Source Beutler Lab
Gene Symbol Ifit3
Ensembl Gene ENSMUSG00000074896
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3
SynonymsIfi49
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8142 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location34583531-34588731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34587501 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 149 (C149F)
Ref Sequence ENSEMBL: ENSMUSP00000099889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102825]
Predicted Effect probably damaging
Transcript: ENSMUST00000102825
AA Change: C149F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: C149F

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 6e-6 BLAST
low complexity region 209 218 N/A INTRINSIC
TPR 241 274 1.02e1 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Dusp5 T C 19: 53,537,481 F185L probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Ifit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1501:Ifit3 UTSW 19 34588251 missense probably benign 0.13
R1521:Ifit3 UTSW 19 34587173 missense probably damaging 1.00
R3084:Ifit3 UTSW 19 34587240 missense probably damaging 0.99
R5017:Ifit3 UTSW 19 34587192 missense possibly damaging 0.78
R5306:Ifit3 UTSW 19 34587807 missense probably damaging 1.00
R6194:Ifit3 UTSW 19 34587627 missense probably benign 0.06
R6523:Ifit3 UTSW 19 34588155 missense probably benign 0.10
R6559:Ifit3 UTSW 19 34587114 missense probably damaging 1.00
R7535:Ifit3 UTSW 19 34587880 missense probably damaging 0.98
R7947:Ifit3 UTSW 19 34587959 nonsense probably null
R8049:Ifit3 UTSW 19 34588080 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAATCAGAAATTCGTCGACTGG -3'
(R):5'- CCATCCTCAGCAGTTTCAGG -3'

Sequencing Primer
(F):5'- AGAAATTCGTCGACTGGTCACCTG -3'
(R):5'- TTCAGGGCCAGGAGAACTTTC -3'
Posted On2020-06-30