Incidental Mutation 'R8142:Dusp5'
ID632614
Institutional Source Beutler Lab
Gene Symbol Dusp5
Ensembl Gene ENSMUSG00000034765
Gene Namedual specificity phosphatase 5
SynonymsLOC240672
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8142 (G1)
Quality Score194.009
Status Not validated
Chromosome19
Chromosomal Location53529109-53542431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53537481 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 185 (F185L)
Ref Sequence ENSEMBL: ENSMUSP00000047900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038287]
Predicted Effect probably damaging
Transcript: ENSMUST00000038287
AA Change: F185L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047900
Gene: ENSMUSG00000034765
AA Change: F185L

DomainStartEndE-ValueType
RHOD 9 138 1.88e-13 SMART
DSPc 178 316 4.48e-56 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, is expressed in a variety of tissues with the highest levels in pancreas and brain, and is localized in the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased proliferation and apoptosis and altered metabolic profiles in T cells. Mice homozygous for other null alleles exhibit altered eosinophilic response to parasicitc infection and increased susceptibility to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1e2 A T 17: 86,944,655 I105N possibly damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bmpr2 T C 1: 59,870,306 S980P probably damaging Het
Ccno T G 13: 112,988,955 L151R probably damaging Het
Cdh2 A C 18: 16,601,734 I801S probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dab1 T A 4: 104,678,724 V110D probably damaging Het
Dnah3 T C 7: 120,060,966 T828A probably benign Het
Dnah5 G T 15: 28,384,373 V3088L probably benign Het
Dtd2 T A 12: 51,999,810 D82V probably damaging Het
Epha10 A G 4: 124,885,846 T162A probably damaging Het
Fat4 A T 3: 38,891,203 D1415V probably damaging Het
Fitm1 T C 14: 55,575,790 Y37H possibly damaging Het
Flg2 G T 3: 93,215,475 E1651* probably null Het
Gm15922 A G 7: 3,736,843 S418P possibly damaging Het
Ifit3 G T 19: 34,587,501 C149F probably damaging Het
Lepr C A 4: 101,765,419 H465Q possibly damaging Het
Ltn1 A C 16: 87,381,641 S1567A probably benign Het
March1 T C 8: 66,456,126 V166A probably benign Het
Marveld2 T C 13: 100,600,940 H424R possibly damaging Het
Mypop A G 7: 19,001,126 T383A unknown Het
Ngef G C 1: 87,540,741 R99G probably benign Het
Npepps G T 11: 97,218,572 A726D probably damaging Het
Olfr766-ps1 T A 10: 129,064,650 D9V probably benign Het
Pcdhgb4 A G 18: 37,721,113 D187G probably damaging Het
Pdzd3 A G 9: 44,250,781 probably null Het
Per2 T C 1: 91,421,547 E1034G possibly damaging Het
Pkhd1l1 G A 15: 44,514,931 R1027H probably benign Het
Pon2 A T 6: 5,266,239 V260D probably benign Het
Rnase13 A G 14: 51,922,436 I82T probably damaging Het
Sbno1 A G 5: 124,408,545 S194P probably benign Het
Serpinb6c T A 13: 33,880,113 I320L probably benign Het
Sh3rf3 C T 10: 59,049,383 R363* probably null Het
Slc11a1 T C 1: 74,385,259 F500L probably benign Het
Slc1a4 A G 11: 20,307,890 probably null Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Sorcs2 T C 5: 36,062,614 N362S possibly damaging Het
Stau2 A G 1: 16,460,351 S115P unknown Het
Stk38l A G 6: 146,758,572 N34S probably benign Het
Tmem201 T C 4: 149,718,657 T585A probably benign Het
Ttc6 A T 12: 57,697,472 I1297F possibly damaging Het
Uncx A G 5: 139,546,900 D240G possibly damaging Het
Vmn2r88 A G 14: 51,414,107 I293V Het
Vps11 T C 9: 44,354,555 T476A probably benign Het
Vrtn T C 12: 84,650,621 L715P probably damaging Het
Wdr72 T G 9: 74,139,667 V65G probably damaging Het
Zbtb21 T C 16: 97,951,475 E536G probably damaging Het
Zbtb34 G T 2: 33,412,481 S16* probably null Het
Zfhx2 G A 14: 55,073,438 L600F possibly damaging Het
Other mutations in Dusp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Dusp5 APN 19 53537473 missense probably damaging 1.00
IGL02017:Dusp5 APN 19 53537506 missense probably damaging 1.00
R4523:Dusp5 UTSW 19 53537601 missense probably damaging 1.00
R5350:Dusp5 UTSW 19 53541234 missense probably damaging 1.00
R7941:Dusp5 UTSW 19 53537533 missense probably benign
R8021:Dusp5 UTSW 19 53529498 missense probably benign 0.13
R8155:Dusp5 UTSW 19 53541106 nonsense probably null
R8336:Dusp5 UTSW 19 53540975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAGTCATGAGGGTAGAG -3'
(R):5'- TGGGAGCTAATGTCAGCAGTG -3'

Sequencing Primer
(F):5'- AGTGCCAGGGTGCAGGTAC -3'
(R):5'- AGCAGTGTGGCTGTCCTC -3'
Posted On2020-06-30