Incidental Mutation 'R8143:Ifi208'
ID632618
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8143 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173682676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 132 (D132E)
Ref Sequence ENSEMBL: ENSMUSP00000083039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085876
AA Change: D132E

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: D132E

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169857
AA Change: D132E

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: D132E

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,375,872 C262F probably damaging Het
4932438A13Rik T G 3: 36,946,508 probably null Het
Acss1 T C 2: 150,667,881 probably null Het
Adamtsl1 T C 4: 86,342,255 V909A possibly damaging Het
Adprh G A 16: 38,450,332 T37M probably benign Het
Ak9 T A 10: 41,337,592 Y264* probably null Het
Aox3 G T 1: 58,158,915 A629S probably benign Het
Apcs G A 1: 172,894,333 P149S probably damaging Het
Arnt T A 3: 95,469,983 probably null Het
Asb13 G A 13: 3,642,065 G15D probably damaging Het
Cacnb1 T G 11: 98,003,320 T459P probably benign Het
Chrnb2 T C 3: 89,747,323 T718A unknown Het
Cttn T A 7: 144,461,262 K70* probably null Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp39a1 T C 17: 43,725,626 V349A probably benign Het
Ebf2 C A 14: 67,411,937 Y430* probably null Het
Eef2 T C 10: 81,181,348 Y730H probably damaging Het
Eif2ak2 G A 17: 78,858,532 T412I probably benign Het
Flnc G C 6: 29,441,485 R422P probably benign Het
Fryl G A 5: 73,050,339 A2496V probably benign Het
Galnt6 A G 15: 100,716,207 L71P probably damaging Het
Gm7579 C T 7: 142,212,426 Q190* probably null Het
H2-T3 T A 17: 36,187,492 R220S probably benign Het
Hmcn1 A G 1: 150,859,206 V185A probably benign Het
Itgb4 G A 11: 115,993,429 V981I probably damaging Het
Itsn2 A G 12: 4,633,003 T310A unknown Het
Kat5 A G 19: 5,607,549 probably null Het
Kif22 A T 7: 127,033,225 D304E probably damaging Het
Mapre3 A T 5: 30,863,375 N147Y possibly damaging Het
Morc2a T C 11: 3,678,537 V330A probably benign Het
Mylk G A 16: 34,914,155 V709M possibly damaging Het
Myo3a T G 2: 22,282,665 probably null Het
N4bp2l2 A T 5: 150,662,205 D103E probably benign Het
Nckap1 T C 2: 80,506,186 K1062R possibly damaging Het
Nol9 T C 4: 152,041,102 V170A possibly damaging Het
Numa1 A G 7: 101,999,684 Q874R possibly damaging Het
Olfr854 A G 9: 19,567,291 V31A probably benign Het
Olig3 T G 10: 19,356,984 V119G probably damaging Het
Osbpl9 A G 4: 109,065,709 S485P probably benign Het
Otogl A G 10: 107,806,666 F1301S probably damaging Het
Pank3 A G 11: 35,776,209 Y51C probably damaging Het
Pex5l T C 3: 33,082,509 probably benign Het
Pgm2 G A 4: 99,967,218 probably null Het
Psmd9 T G 5: 123,228,416 I37S probably damaging Het
Qtrt2 A G 16: 43,871,754 S135P probably damaging Het
Rexo5 T A 7: 119,834,261 probably null Het
Rsrp1 T A 4: 134,927,008 D286E probably benign Het
Scara3 C T 14: 65,931,820 C116Y probably damaging Het
Serpina3b A T 12: 104,130,534 T25S probably benign Het
Sh3pxd2a G A 19: 47,268,699 P555S probably damaging Het
Slc1a2 T A 2: 102,737,885 L89Q probably damaging Het
Tgm6 T A 2: 130,141,843 N307K probably damaging Het
Tmem86b G T 7: 4,628,485 D189E probably damaging Het
Trim65 G A 11: 116,126,461 R392C probably benign Het
Trpc7 T C 13: 56,782,549 T769A probably benign Het
Trrap T A 5: 144,835,897 probably null Het
Ttn T C 2: 76,863,333 E397G possibly damaging Het
Vcl A T 14: 20,987,044 M237L possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Vmn2r23 A T 6: 123,741,353 D555V probably damaging Het
Wnk4 A G 11: 101,262,799 N229S probably damaging Het
Zfp784 A C 7: 5,035,911 V216G possibly damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGTGTCCACGTTTCTAAGAGAC -3'
(R):5'- ATTTCTGTAGGCTCCAGGGG -3'

Sequencing Primer
(F):5'- GTCCACGTTTCTAAGAGACATTCTG -3'
(R):5'- CAGGGGTGTCTGGAGACTGC -3'
Posted On2020-06-30