Incidental Mutation 'R8143:Vmn2r23'
ID 632637
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 067571-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8143 (G1)
Quality Score 153.008
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123718312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 555 (D555V)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: D555V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: D555V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,265,884 (GRCm39) C262F probably damaging Het
Acss1 T C 2: 150,509,801 (GRCm39) probably null Het
Adamtsl1 T C 4: 86,260,492 (GRCm39) V909A possibly damaging Het
Adprh G A 16: 38,270,694 (GRCm39) T37M probably benign Het
Ak9 T A 10: 41,213,588 (GRCm39) Y264* probably null Het
Aox3 G T 1: 58,198,074 (GRCm39) A629S probably benign Het
Apcs G A 1: 172,721,900 (GRCm39) P149S probably damaging Het
Arnt T A 3: 95,377,294 (GRCm39) probably null Het
Asb13 G A 13: 3,692,065 (GRCm39) G15D probably damaging Het
Bltp1 T G 3: 37,000,657 (GRCm39) probably null Het
Cacnb1 T G 11: 97,894,146 (GRCm39) T459P probably benign Het
Chrnb2 T C 3: 89,654,630 (GRCm39) T718A unknown Het
Cttn T A 7: 144,014,999 (GRCm39) K70* probably null Het
Cyp2f2 G A 7: 26,828,678 (GRCm39) V183I probably benign Het
Cyp39a1 T C 17: 44,036,517 (GRCm39) V349A probably benign Het
Ebf2 C A 14: 67,649,386 (GRCm39) Y430* probably null Het
Eef2 T C 10: 81,017,182 (GRCm39) Y730H probably damaging Het
Eif2ak2 G A 17: 79,165,961 (GRCm39) T412I probably benign Het
Flnc G C 6: 29,441,484 (GRCm39) R422P probably benign Het
Fryl G A 5: 73,207,682 (GRCm39) A2496V probably benign Het
Galnt6 A G 15: 100,614,088 (GRCm39) L71P probably damaging Het
Gm7579 C T 7: 141,766,163 (GRCm39) Q190* probably null Het
H2-T3 T A 17: 36,498,384 (GRCm39) R220S probably benign Het
Hmcn1 A G 1: 150,734,957 (GRCm39) V185A probably benign Het
Ifi208 T A 1: 173,510,242 (GRCm39) D132E possibly damaging Het
Itgb4 G A 11: 115,884,255 (GRCm39) V981I probably damaging Het
Itsn2 A G 12: 4,683,003 (GRCm39) T310A unknown Het
Kat5 A G 19: 5,657,577 (GRCm39) probably null Het
Kif22 A T 7: 126,632,397 (GRCm39) D304E probably damaging Het
Mapre3 A T 5: 31,020,719 (GRCm39) N147Y possibly damaging Het
Morc2a T C 11: 3,628,537 (GRCm39) V330A probably benign Het
Mylk G A 16: 34,734,525 (GRCm39) V709M possibly damaging Het
Myo3a T G 2: 22,287,476 (GRCm39) probably null Het
N4bp2l2 A T 5: 150,585,670 (GRCm39) D103E probably benign Het
Nckap1 T C 2: 80,336,530 (GRCm39) K1062R possibly damaging Het
Nol9 T C 4: 152,125,559 (GRCm39) V170A possibly damaging Het
Numa1 A G 7: 101,648,891 (GRCm39) Q874R possibly damaging Het
Olig3 T G 10: 19,232,732 (GRCm39) V119G probably damaging Het
Or7g34 A G 9: 19,478,587 (GRCm39) V31A probably benign Het
Osbpl9 A G 4: 108,922,906 (GRCm39) S485P probably benign Het
Otogl A G 10: 107,642,527 (GRCm39) F1301S probably damaging Het
Pank3 A G 11: 35,667,036 (GRCm39) Y51C probably damaging Het
Pex5l T C 3: 33,136,658 (GRCm39) probably benign Het
Pgm1 G A 4: 99,824,415 (GRCm39) probably null Het
Psmd9 T G 5: 123,366,479 (GRCm39) I37S probably damaging Het
Qtrt2 A G 16: 43,692,117 (GRCm39) S135P probably damaging Het
Rexo5 T A 7: 119,433,484 (GRCm39) probably null Het
Rsrp1 T A 4: 134,654,319 (GRCm39) D286E probably benign Het
Scara3 C T 14: 66,169,269 (GRCm39) C116Y probably damaging Het
Serpina3b A T 12: 104,096,793 (GRCm39) T25S probably benign Het
Sh3pxd2a G A 19: 47,257,138 (GRCm39) P555S probably damaging Het
Slc1a2 T A 2: 102,568,230 (GRCm39) L89Q probably damaging Het
Tgm6 T A 2: 129,983,763 (GRCm39) N307K probably damaging Het
Tmem86b G T 7: 4,631,484 (GRCm39) D189E probably damaging Het
Trim65 G A 11: 116,017,287 (GRCm39) R392C probably benign Het
Trpc7 T C 13: 56,930,362 (GRCm39) T769A probably benign Het
Trrap T A 5: 144,772,707 (GRCm39) probably null Het
Ttn T C 2: 76,693,677 (GRCm39) E397G possibly damaging Het
Vcl A T 14: 21,037,112 (GRCm39) M237L possibly damaging Het
Vmn1r36 G A 6: 66,693,036 (GRCm39) Q280* probably null Het
Wnk4 A G 11: 101,153,625 (GRCm39) N229S probably damaging Het
Zfp784 A C 7: 5,038,910 (GRCm39) V216G possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGTTCTCATATTGTTCAAGTCCAC -3'
(R):5'- GCTCTGACAATGGGTGTATCC -3'

Sequencing Primer
(F):5'- ATTGTTCAAGTCCACTAACTTTCTG -3'
(R):5'- TCCCAGAGTATCTTCATGGG -3'
Posted On 2020-06-30