Mutagenetix > Incidental Mutation

Incidental Mutation 'R8143:Vmn2r23'

632637

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R8143 (G1)

Quality Score

153.008

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123741353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 555 (D555V)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: D555V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: D555V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 99.7%
3x: 99.4%
10x: 97.3%
20x: 85.9%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	C	A	2: 35,375,872	C262F	probably damaging	Het
4932438A13Rik	T	G	3: 36,946,508		probably null	Het
Acss1	T	C	2: 150,667,881		probably null	Het
Adamtsl1	T	C	4: 86,342,255	V909A	possibly damaging	Het
Adprh	G	A	16: 38,450,332	T37M	probably benign	Het
Ak9	T	A	10: 41,337,592	Y264*	probably null	Het
Aox3	G	T	1: 58,158,915	A629S	probably benign	Het
Apcs	G	A	1: 172,894,333	P149S	probably damaging	Het
Arnt	T	A	3: 95,469,983		probably null	Het
Asb13	G	A	13: 3,642,065	G15D	probably damaging	Het
Cacnb1	T	G	11: 98,003,320	T459P	probably benign	Het
Chrnb2	T	C	3: 89,747,323	T718A	unknown	Het
Cttn	T	A	7: 144,461,262	K70*	probably null	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Cyp39a1	T	C	17: 43,725,626	V349A	probably benign	Het
Ebf2	C	A	14: 67,411,937	Y430*	probably null	Het
Eef2	T	C	10: 81,181,348	Y730H	probably damaging	Het
Eif2ak2	G	A	17: 78,858,532	T412I	probably benign	Het
Flnc	G	C	6: 29,441,485	R422P	probably benign	Het
Fryl	G	A	5: 73,050,339	A2496V	probably benign	Het
Galnt6	A	G	15: 100,716,207	L71P	probably damaging	Het
Gm7579	C	T	7: 142,212,426	Q190*	probably null	Het
H2-T3	T	A	17: 36,187,492	R220S	probably benign	Het
Hmcn1	A	G	1: 150,859,206	V185A	probably benign	Het
Ifi208	T	A	1: 173,682,676	D132E	possibly damaging	Het
Itgb4	G	A	11: 115,993,429	V981I	probably damaging	Het
Itsn2	A	G	12: 4,633,003	T310A	unknown	Het
Kat5	A	G	19: 5,607,549		probably null	Het
Kif22	A	T	7: 127,033,225	D304E	probably damaging	Het
Mapre3	A	T	5: 30,863,375	N147Y	possibly damaging	Het
Morc2a	T	C	11: 3,678,537	V330A	probably benign	Het
Mylk	G	A	16: 34,914,155	V709M	possibly damaging	Het
Myo3a	T	G	2: 22,282,665		probably null	Het
N4bp2l2	A	T	5: 150,662,205	D103E	probably benign	Het
Nckap1	T	C	2: 80,506,186	K1062R	possibly damaging	Het
Nol9	T	C	4: 152,041,102	V170A	possibly damaging	Het
Numa1	A	G	7: 101,999,684	Q874R	possibly damaging	Het
Olfr854	A	G	9: 19,567,291	V31A	probably benign	Het
Olig3	T	G	10: 19,356,984	V119G	probably damaging	Het
Osbpl9	A	G	4: 109,065,709	S485P	probably benign	Het
Otogl	A	G	10: 107,806,666	F1301S	probably damaging	Het
Pank3	A	G	11: 35,776,209	Y51C	probably damaging	Het
Pex5l	T	C	3: 33,082,509		probably benign	Het
Pgm2	G	A	4: 99,967,218		probably null	Het
Psmd9	T	G	5: 123,228,416	I37S	probably damaging	Het
Qtrt2	A	G	16: 43,871,754	S135P	probably damaging	Het
Rexo5	T	A	7: 119,834,261		probably null	Het
Rsrp1	T	A	4: 134,927,008	D286E	probably benign	Het
Scara3	C	T	14: 65,931,820	C116Y	probably damaging	Het
Serpina3b	A	T	12: 104,130,534	T25S	probably benign	Het
Sh3pxd2a	G	A	19: 47,268,699	P555S	probably damaging	Het
Slc1a2	T	A	2: 102,737,885	L89Q	probably damaging	Het
Tgm6	T	A	2: 130,141,843	N307K	probably damaging	Het
Tmem86b	G	T	7: 4,628,485	D189E	probably damaging	Het
Trim65	G	A	11: 116,126,461	R392C	probably benign	Het
Trpc7	T	C	13: 56,782,549	T769A	probably benign	Het
Trrap	T	A	5: 144,835,897		probably null	Het
Ttn	T	C	2: 76,863,333	E397G	possibly damaging	Het
Vcl	A	T	14: 20,987,044	M237L	possibly damaging	Het
Vmn1r36	G	A	6: 66,716,052	Q280*	probably null	Het
Wnk4	A	G	11: 101,262,799	N229S	probably damaging	Het
Zfp784	A	C	7: 5,035,911	V216G	possibly damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GATGTTCTCATATTGTTCAAGTCCAC -3'
(R):5'- GCTCTGACAATGGGTGTATCC -3'

Sequencing Primer
(F):5'- ATTGTTCAAGTCCACTAACTTTCTG -3'
(R):5'- TCCCAGAGTATCTTCATGGG -3'

Posted On

2020-06-30