Incidental Mutation 'R8143:Vmn2r23'
ID632637
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8143 (G1)
Quality Score153.008
Status Validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123741353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 555 (D555V)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: D555V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: D555V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,375,872 C262F probably damaging Het
4932438A13Rik T G 3: 36,946,508 probably null Het
Acss1 T C 2: 150,667,881 probably null Het
Adamtsl1 T C 4: 86,342,255 V909A possibly damaging Het
Adprh G A 16: 38,450,332 T37M probably benign Het
Ak9 T A 10: 41,337,592 Y264* probably null Het
Aox3 G T 1: 58,158,915 A629S probably benign Het
Apcs G A 1: 172,894,333 P149S probably damaging Het
Arnt T A 3: 95,469,983 probably null Het
Asb13 G A 13: 3,642,065 G15D probably damaging Het
Cacnb1 T G 11: 98,003,320 T459P probably benign Het
Chrnb2 T C 3: 89,747,323 T718A unknown Het
Cttn T A 7: 144,461,262 K70* probably null Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp39a1 T C 17: 43,725,626 V349A probably benign Het
Ebf2 C A 14: 67,411,937 Y430* probably null Het
Eef2 T C 10: 81,181,348 Y730H probably damaging Het
Eif2ak2 G A 17: 78,858,532 T412I probably benign Het
Flnc G C 6: 29,441,485 R422P probably benign Het
Fryl G A 5: 73,050,339 A2496V probably benign Het
Galnt6 A G 15: 100,716,207 L71P probably damaging Het
Gm7579 C T 7: 142,212,426 Q190* probably null Het
H2-T3 T A 17: 36,187,492 R220S probably benign Het
Hmcn1 A G 1: 150,859,206 V185A probably benign Het
Ifi208 T A 1: 173,682,676 D132E possibly damaging Het
Itgb4 G A 11: 115,993,429 V981I probably damaging Het
Itsn2 A G 12: 4,633,003 T310A unknown Het
Kat5 A G 19: 5,607,549 probably null Het
Kif22 A T 7: 127,033,225 D304E probably damaging Het
Mapre3 A T 5: 30,863,375 N147Y possibly damaging Het
Morc2a T C 11: 3,678,537 V330A probably benign Het
Mylk G A 16: 34,914,155 V709M possibly damaging Het
Myo3a T G 2: 22,282,665 probably null Het
N4bp2l2 A T 5: 150,662,205 D103E probably benign Het
Nckap1 T C 2: 80,506,186 K1062R possibly damaging Het
Nol9 T C 4: 152,041,102 V170A possibly damaging Het
Numa1 A G 7: 101,999,684 Q874R possibly damaging Het
Olfr854 A G 9: 19,567,291 V31A probably benign Het
Olig3 T G 10: 19,356,984 V119G probably damaging Het
Osbpl9 A G 4: 109,065,709 S485P probably benign Het
Otogl A G 10: 107,806,666 F1301S probably damaging Het
Pank3 A G 11: 35,776,209 Y51C probably damaging Het
Pex5l T C 3: 33,082,509 probably benign Het
Pgm2 G A 4: 99,967,218 probably null Het
Psmd9 T G 5: 123,228,416 I37S probably damaging Het
Qtrt2 A G 16: 43,871,754 S135P probably damaging Het
Rexo5 T A 7: 119,834,261 probably null Het
Rsrp1 T A 4: 134,927,008 D286E probably benign Het
Scara3 C T 14: 65,931,820 C116Y probably damaging Het
Serpina3b A T 12: 104,130,534 T25S probably benign Het
Sh3pxd2a G A 19: 47,268,699 P555S probably damaging Het
Slc1a2 T A 2: 102,737,885 L89Q probably damaging Het
Tgm6 T A 2: 130,141,843 N307K probably damaging Het
Tmem86b G T 7: 4,628,485 D189E probably damaging Het
Trim65 G A 11: 116,126,461 R392C probably benign Het
Trpc7 T C 13: 56,782,549 T769A probably benign Het
Trrap T A 5: 144,835,897 probably null Het
Ttn T C 2: 76,863,333 E397G possibly damaging Het
Vcl A T 14: 20,987,044 M237L possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Wnk4 A G 11: 101,262,799 N229S probably damaging Het
Zfp784 A C 7: 5,035,911 V216G possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGTTCTCATATTGTTCAAGTCCAC -3'
(R):5'- GCTCTGACAATGGGTGTATCC -3'

Sequencing Primer
(F):5'- ATTGTTCAAGTCCACTAACTTTCTG -3'
(R):5'- TCCCAGAGTATCTTCATGGG -3'
Posted On2020-06-30