Incidental Mutation 'R8143:Serpina3b'
ID 632657
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms alpha-1 antiproteinase, 6A1, antitrypsin, A030003A19Rik
MMRRC Submission 067571-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8143 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104094255-104105804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104096793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 25 (T25S)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
AlphaFold Q8BYY9
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: T25S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: T25S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,265,884 (GRCm39) C262F probably damaging Het
Acss1 T C 2: 150,509,801 (GRCm39) probably null Het
Adamtsl1 T C 4: 86,260,492 (GRCm39) V909A possibly damaging Het
Adprh G A 16: 38,270,694 (GRCm39) T37M probably benign Het
Ak9 T A 10: 41,213,588 (GRCm39) Y264* probably null Het
Aox3 G T 1: 58,198,074 (GRCm39) A629S probably benign Het
Apcs G A 1: 172,721,900 (GRCm39) P149S probably damaging Het
Arnt T A 3: 95,377,294 (GRCm39) probably null Het
Asb13 G A 13: 3,692,065 (GRCm39) G15D probably damaging Het
Bltp1 T G 3: 37,000,657 (GRCm39) probably null Het
Cacnb1 T G 11: 97,894,146 (GRCm39) T459P probably benign Het
Chrnb2 T C 3: 89,654,630 (GRCm39) T718A unknown Het
Cttn T A 7: 144,014,999 (GRCm39) K70* probably null Het
Cyp2f2 G A 7: 26,828,678 (GRCm39) V183I probably benign Het
Cyp39a1 T C 17: 44,036,517 (GRCm39) V349A probably benign Het
Ebf2 C A 14: 67,649,386 (GRCm39) Y430* probably null Het
Eef2 T C 10: 81,017,182 (GRCm39) Y730H probably damaging Het
Eif2ak2 G A 17: 79,165,961 (GRCm39) T412I probably benign Het
Flnc G C 6: 29,441,484 (GRCm39) R422P probably benign Het
Fryl G A 5: 73,207,682 (GRCm39) A2496V probably benign Het
Galnt6 A G 15: 100,614,088 (GRCm39) L71P probably damaging Het
Gm7579 C T 7: 141,766,163 (GRCm39) Q190* probably null Het
H2-T3 T A 17: 36,498,384 (GRCm39) R220S probably benign Het
Hmcn1 A G 1: 150,734,957 (GRCm39) V185A probably benign Het
Ifi208 T A 1: 173,510,242 (GRCm39) D132E possibly damaging Het
Itgb4 G A 11: 115,884,255 (GRCm39) V981I probably damaging Het
Itsn2 A G 12: 4,683,003 (GRCm39) T310A unknown Het
Kat5 A G 19: 5,657,577 (GRCm39) probably null Het
Kif22 A T 7: 126,632,397 (GRCm39) D304E probably damaging Het
Mapre3 A T 5: 31,020,719 (GRCm39) N147Y possibly damaging Het
Morc2a T C 11: 3,628,537 (GRCm39) V330A probably benign Het
Mylk G A 16: 34,734,525 (GRCm39) V709M possibly damaging Het
Myo3a T G 2: 22,287,476 (GRCm39) probably null Het
N4bp2l2 A T 5: 150,585,670 (GRCm39) D103E probably benign Het
Nckap1 T C 2: 80,336,530 (GRCm39) K1062R possibly damaging Het
Nol9 T C 4: 152,125,559 (GRCm39) V170A possibly damaging Het
Numa1 A G 7: 101,648,891 (GRCm39) Q874R possibly damaging Het
Olig3 T G 10: 19,232,732 (GRCm39) V119G probably damaging Het
Or7g34 A G 9: 19,478,587 (GRCm39) V31A probably benign Het
Osbpl9 A G 4: 108,922,906 (GRCm39) S485P probably benign Het
Otogl A G 10: 107,642,527 (GRCm39) F1301S probably damaging Het
Pank3 A G 11: 35,667,036 (GRCm39) Y51C probably damaging Het
Pex5l T C 3: 33,136,658 (GRCm39) probably benign Het
Pgm1 G A 4: 99,824,415 (GRCm39) probably null Het
Psmd9 T G 5: 123,366,479 (GRCm39) I37S probably damaging Het
Qtrt2 A G 16: 43,692,117 (GRCm39) S135P probably damaging Het
Rexo5 T A 7: 119,433,484 (GRCm39) probably null Het
Rsrp1 T A 4: 134,654,319 (GRCm39) D286E probably benign Het
Scara3 C T 14: 66,169,269 (GRCm39) C116Y probably damaging Het
Sh3pxd2a G A 19: 47,257,138 (GRCm39) P555S probably damaging Het
Slc1a2 T A 2: 102,568,230 (GRCm39) L89Q probably damaging Het
Tgm6 T A 2: 129,983,763 (GRCm39) N307K probably damaging Het
Tmem86b G T 7: 4,631,484 (GRCm39) D189E probably damaging Het
Trim65 G A 11: 116,017,287 (GRCm39) R392C probably benign Het
Trpc7 T C 13: 56,930,362 (GRCm39) T769A probably benign Het
Trrap T A 5: 144,772,707 (GRCm39) probably null Het
Ttn T C 2: 76,693,677 (GRCm39) E397G possibly damaging Het
Vcl A T 14: 21,037,112 (GRCm39) M237L possibly damaging Het
Vmn1r36 G A 6: 66,693,036 (GRCm39) Q280* probably null Het
Vmn2r23 A T 6: 123,718,312 (GRCm39) D555V probably damaging Het
Wnk4 A G 11: 101,153,625 (GRCm39) N229S probably damaging Het
Zfp784 A C 7: 5,038,910 (GRCm39) V216G possibly damaging Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104,105,046 (GRCm39) missense probably benign 0.03
IGL00427:Serpina3b APN 12 104,099,200 (GRCm39) missense probably benign 0.06
IGL01637:Serpina3b APN 12 104,099,216 (GRCm39) missense probably benign 0.00
IGL01738:Serpina3b APN 12 104,097,091 (GRCm39) missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104,096,721 (GRCm39) start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104,097,313 (GRCm39) missense probably benign 0.22
R0141:Serpina3b UTSW 12 104,097,030 (GRCm39) missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104,096,986 (GRCm39) missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104,096,929 (GRCm39) missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104,097,138 (GRCm39) missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104,104,969 (GRCm39) missense probably benign 0.02
R1802:Serpina3b UTSW 12 104,104,896 (GRCm39) missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104,105,069 (GRCm39) missense probably benign 0.01
R3871:Serpina3b UTSW 12 104,105,047 (GRCm39) missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104,096,889 (GRCm39) missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104,097,036 (GRCm39) missense probably benign 0.02
R5970:Serpina3b UTSW 12 104,100,350 (GRCm39) missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104,097,356 (GRCm39) missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104,100,428 (GRCm39) missense probably benign 0.00
R6673:Serpina3b UTSW 12 104,096,928 (GRCm39) missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104,099,251 (GRCm39) missense probably benign 0.00
R6836:Serpina3b UTSW 12 104,100,341 (GRCm39) missense probably benign 0.30
R6893:Serpina3b UTSW 12 104,099,285 (GRCm39) missense probably benign 0.04
R7414:Serpina3b UTSW 12 104,099,145 (GRCm39) missense probably benign 0.03
R7539:Serpina3b UTSW 12 104,096,970 (GRCm39) missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104,096,722 (GRCm39) start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104,099,223 (GRCm39) missense probably benign 0.01
R8040:Serpina3b UTSW 12 104,097,335 (GRCm39) missense probably benign 0.00
R8360:Serpina3b UTSW 12 104,104,962 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCAGAACATCTCCCGTAG -3'
(R):5'- CCCAGAGTCAAGGAGTTCAG -3'

Sequencing Primer
(F):5'- CCGTAGGCAGTCACAGAGAC -3'
(R):5'- TCAAGGAGTTCAGAGCAGTTGC -3'
Posted On 2020-06-30