Incidental Mutation 'R8143:Qtrt2'
ID 632666
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Name queuine tRNA-ribosyltransferase accessory subunit 2
Synonyms 3110012M05Rik, 4930470H18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8143 (G1)
Quality Score 143.008
Status Validated
Chromosome 16
Chromosomal Location 43861407-43926809 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43871754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000023387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023387
AA Change: S135P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704
AA Change: S135P

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 85.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,375,872 C262F probably damaging Het
4932438A13Rik T G 3: 36,946,508 probably null Het
Acss1 T C 2: 150,667,881 probably null Het
Adamtsl1 T C 4: 86,342,255 V909A possibly damaging Het
Adprh G A 16: 38,450,332 T37M probably benign Het
Ak9 T A 10: 41,337,592 Y264* probably null Het
Aox3 G T 1: 58,158,915 A629S probably benign Het
Apcs G A 1: 172,894,333 P149S probably damaging Het
Arnt T A 3: 95,469,983 probably null Het
Asb13 G A 13: 3,642,065 G15D probably damaging Het
Cacnb1 T G 11: 98,003,320 T459P probably benign Het
Chrnb2 T C 3: 89,747,323 T718A unknown Het
Cttn T A 7: 144,461,262 K70* probably null Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp39a1 T C 17: 43,725,626 V349A probably benign Het
Ebf2 C A 14: 67,411,937 Y430* probably null Het
Eef2 T C 10: 81,181,348 Y730H probably damaging Het
Eif2ak2 G A 17: 78,858,532 T412I probably benign Het
Flnc G C 6: 29,441,485 R422P probably benign Het
Fryl G A 5: 73,050,339 A2496V probably benign Het
Galnt6 A G 15: 100,716,207 L71P probably damaging Het
Gm7579 C T 7: 142,212,426 Q190* probably null Het
H2-T3 T A 17: 36,187,492 R220S probably benign Het
Hmcn1 A G 1: 150,859,206 V185A probably benign Het
Ifi208 T A 1: 173,682,676 D132E possibly damaging Het
Itgb4 G A 11: 115,993,429 V981I probably damaging Het
Itsn2 A G 12: 4,633,003 T310A unknown Het
Kat5 A G 19: 5,607,549 probably null Het
Kif22 A T 7: 127,033,225 D304E probably damaging Het
Mapre3 A T 5: 30,863,375 N147Y possibly damaging Het
Morc2a T C 11: 3,678,537 V330A probably benign Het
Mylk G A 16: 34,914,155 V709M possibly damaging Het
Myo3a T G 2: 22,282,665 probably null Het
N4bp2l2 A T 5: 150,662,205 D103E probably benign Het
Nckap1 T C 2: 80,506,186 K1062R possibly damaging Het
Nol9 T C 4: 152,041,102 V170A possibly damaging Het
Numa1 A G 7: 101,999,684 Q874R possibly damaging Het
Olfr854 A G 9: 19,567,291 V31A probably benign Het
Olig3 T G 10: 19,356,984 V119G probably damaging Het
Osbpl9 A G 4: 109,065,709 S485P probably benign Het
Otogl A G 10: 107,806,666 F1301S probably damaging Het
Pank3 A G 11: 35,776,209 Y51C probably damaging Het
Pex5l T C 3: 33,082,509 probably benign Het
Pgm2 G A 4: 99,967,218 probably null Het
Psmd9 T G 5: 123,228,416 I37S probably damaging Het
Rexo5 T A 7: 119,834,261 probably null Het
Rsrp1 T A 4: 134,927,008 D286E probably benign Het
Scara3 C T 14: 65,931,820 C116Y probably damaging Het
Serpina3b A T 12: 104,130,534 T25S probably benign Het
Sh3pxd2a G A 19: 47,268,699 P555S probably damaging Het
Slc1a2 T A 2: 102,737,885 L89Q probably damaging Het
Tgm6 T A 2: 130,141,843 N307K probably damaging Het
Tmem86b G T 7: 4,628,485 D189E probably damaging Het
Trim65 G A 11: 116,126,461 R392C probably benign Het
Trpc7 T C 13: 56,782,549 T769A probably benign Het
Trrap T A 5: 144,835,897 probably null Het
Ttn T C 2: 76,863,333 E397G possibly damaging Het
Vcl A T 14: 20,987,044 M237L possibly damaging Het
Vmn1r36 G A 6: 66,716,052 Q280* probably null Het
Vmn2r23 A T 6: 123,741,353 D555V probably damaging Het
Wnk4 A G 11: 101,262,799 N229S probably damaging Het
Zfp784 A C 7: 5,035,911 V216G possibly damaging Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43881189 missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43878000 missense possibly damaging 0.93
R1258:Qtrt2 UTSW 16 43869083 missense possibly damaging 0.77
R1499:Qtrt2 UTSW 16 43868974 missense probably benign 0.43
R1574:Qtrt2 UTSW 16 43871832 unclassified probably benign
R1830:Qtrt2 UTSW 16 43871655 missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43869092 missense probably damaging 1.00
R3835:Qtrt2 UTSW 16 43881072 missense probably damaging 1.00
R5199:Qtrt2 UTSW 16 43867425 missense probably benign 0.10
R7449:Qtrt2 UTSW 16 43881032 missense probably benign 0.06
R7621:Qtrt2 UTSW 16 43868940 splice site probably null
R8530:Qtrt2 UTSW 16 43869044 missense probably damaging 1.00
R8879:Qtrt2 UTSW 16 43863197 missense probably damaging 1.00
R9629:Qtrt2 UTSW 16 43863177 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCAAGACATGGAAAGGACCCTG -3'
(R):5'- GGTGCATCATTCCCTGTAGAC -3'

Sequencing Primer
(F):5'- TGCATCACACGGTCACCAG -3'
(R):5'- GACATTTTATCTGTAGCACCTTCAG -3'
Posted On 2020-06-30