Incidental Mutation 'R0042:Vwce'
ID63268
Institutional Source Beutler Lab
Gene Symbol Vwce
Ensembl Gene ENSMUSG00000043789
Gene Namevon Willebrand factor C and EGF domains
Synonyms1300015B04Rik
MMRRC Submission 038336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0042 (G1)
Quality Score91
Status Validated
Chromosome19
Chromosomal Location10634233-10665210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10646813 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 356 (A356V)
Ref Sequence ENSEMBL: ENSMUSP00000056958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055115]
Predicted Effect probably benign
Transcript: ENSMUST00000055115
AA Change: A356V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789
AA Change: A356V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik C A 17: 25,947,982 E194* probably null Het
Abca1 C T 4: 53,059,245 probably benign Het
Acr T A 15: 89,574,332 H405Q probably benign Het
Adad1 T C 3: 37,083,173 probably benign Het
Alox5ap T C 5: 149,279,259 probably benign Het
Ank2 T C 3: 126,936,631 D3568G probably damaging Het
Atl3 T G 19: 7,529,023 I306S probably damaging Het
Atr T A 9: 95,927,356 probably benign Het
Ccnb2 A G 9: 70,419,053 V34A probably benign Het
Cdh12 A C 15: 21,537,677 probably benign Het
Cib1 C T 7: 80,230,378 V45M probably benign Het
Col6a6 T C 9: 105,780,697 E772G possibly damaging Het
Dmxl1 C A 18: 49,864,035 T466K probably benign Het
Dym T C 18: 75,125,539 probably null Het
Enpp3 A C 10: 24,774,824 F805V probably damaging Het
Eya1 T C 1: 14,184,489 D373G probably damaging Het
Gpr179 C T 11: 97,334,931 V2133I probably benign Het
Grb10 G T 11: 11,936,798 H435Q probably damaging Het
Gzmm T C 10: 79,694,565 I190T probably benign Het
Helt T C 8: 46,292,396 Y150C probably damaging Het
Hrg A T 16: 22,961,136 probably benign Het
Il17ra T C 6: 120,472,125 probably benign Het
Inhbc A G 10: 127,357,433 I238T probably benign Het
Itgb3 A G 11: 104,667,140 T787A possibly damaging Het
Jakmip2 T G 18: 43,552,145 probably benign Het
Krt4 T G 15: 101,922,752 probably benign Het
Lgsn C T 1: 31,190,453 T85I probably benign Het
Metap1 C T 3: 138,472,157 V217I probably benign Het
Mib2 A T 4: 155,659,440 C48* probably null Het
Mroh4 T A 15: 74,610,305 I768F probably damaging Het
Npas3 T A 12: 54,048,841 D361E probably damaging Het
Obscn A G 11: 59,052,585 L4246P probably damaging Het
Olfr1097 A G 2: 86,890,491 I228T probably damaging Het
Olfr1251 A C 2: 89,667,454 V144G probably benign Het
Olfr860 A G 9: 19,845,779 M280T probably benign Het
P4hb G A 11: 120,568,266 R134C probably damaging Het
Plcb3 T C 19: 6,966,420 D71G probably damaging Het
Prex2 T A 1: 11,080,081 V159E probably damaging Het
Prpsap1 T A 11: 116,479,656 K158N probably benign Het
Ptger1 G T 8: 83,668,166 V91L probably benign Het
Rdh10 T C 1: 16,108,036 probably benign Het
Rgs9bp C A 7: 35,585,033 R63L probably damaging Het
Slc13a5 A T 11: 72,259,114 V173E probably benign Het
Spata31 A T 13: 64,922,563 I842L probably benign Het
Stk32b A C 5: 37,716,748 D13E probably benign Het
Svep1 T C 4: 58,123,192 D708G possibly damaging Het
Taar6 T C 10: 23,985,123 D175G probably benign Het
Thbs1 A C 2: 118,122,877 D925A probably damaging Het
Tnr A T 1: 159,887,025 T825S probably benign Het
Ttc23l A C 15: 10,551,541 L33W probably damaging Het
Ttc39d T C 17: 80,215,950 Y13H probably benign Het
Vmn2r102 C A 17: 19,660,589 P64Q probably damaging Het
Vps11 G T 9: 44,356,291 Y341* probably null Het
Vsig8 T C 1: 172,560,358 V5A possibly damaging Het
Other mutations in Vwce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Vwce APN 19 10664511 unclassified probably null
IGL01358:Vwce APN 19 10664409 missense possibly damaging 0.86
IGL02330:Vwce APN 19 10646801 missense possibly damaging 0.96
IGL02477:Vwce APN 19 10664618 unclassified probably null
IGL02551:Vwce APN 19 10645036 missense possibly damaging 0.71
IGL02606:Vwce APN 19 10655348 splice site probably benign
IGL02633:Vwce APN 19 10648494 missense probably damaging 0.98
IGL02656:Vwce APN 19 10664352 missense probably benign
IGL02884:Vwce APN 19 10646579 missense possibly damaging 0.53
IGL02973:Vwce APN 19 10655400 nonsense probably null
IGL03038:Vwce APN 19 10646671 missense possibly damaging 0.86
IGL03329:Vwce APN 19 10659996 missense possibly damaging 0.73
PIT4403001:Vwce UTSW 19 10638097 missense possibly damaging 0.53
PIT4431001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
PIT4519001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
R0081:Vwce UTSW 19 10664089 critical splice acceptor site probably null
R0142:Vwce UTSW 19 10664612 missense probably damaging 0.97
R0165:Vwce UTSW 19 10659973 splice site probably benign
R0948:Vwce UTSW 19 10653077 missense probably damaging 1.00
R1053:Vwce UTSW 19 10664099 missense probably benign 0.18
R1505:Vwce UTSW 19 10664244 missense probably benign
R1623:Vwce UTSW 19 10646744 nonsense probably null
R1672:Vwce UTSW 19 10653095 missense possibly damaging 0.92
R1882:Vwce UTSW 19 10638156 missense possibly damaging 0.53
R3849:Vwce UTSW 19 10646905 missense probably damaging 0.97
R4292:Vwce UTSW 19 10659632 missense probably benign 0.00
R4293:Vwce UTSW 19 10659632 missense probably benign 0.00
R4531:Vwce UTSW 19 10664346 missense probably benign 0.01
R4678:Vwce UTSW 19 10664648 missense possibly damaging 0.86
R4720:Vwce UTSW 19 10648467 missense possibly damaging 0.85
R4737:Vwce UTSW 19 10650579 missense probably benign 0.33
R4864:Vwce UTSW 19 10650636 missense probably benign 0.01
R4916:Vwce UTSW 19 10646879 missense probably damaging 0.98
R4939:Vwce UTSW 19 10645050 missense probably damaging 0.98
R5605:Vwce UTSW 19 10658038 missense possibly damaging 0.95
R5735:Vwce UTSW 19 10647067 missense probably benign 0.08
R5780:Vwce UTSW 19 10650619 missense probably damaging 1.00
R6158:Vwce UTSW 19 10644221 missense possibly damaging 0.91
R6383:Vwce UTSW 19 10659592 nonsense probably null
R6920:Vwce UTSW 19 10664693 missense probably benign
R7201:Vwce UTSW 19 10638115 missense possibly damaging 0.72
R7276:Vwce UTSW 19 10664174 missense possibly damaging 0.53
R7423:Vwce UTSW 19 10664340 missense probably benign 0.02
R7474:Vwce UTSW 19 10646941 missense possibly damaging 0.93
R7843:Vwce UTSW 19 10664283 missense probably benign 0.01
R7926:Vwce UTSW 19 10664283 missense probably benign 0.01
RF020:Vwce UTSW 19 10653085 missense probably damaging 1.00
X0018:Vwce UTSW 19 10656662 missense possibly damaging 0.86
Z1177:Vwce UTSW 19 10646863 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GACAGCATCCTGCTAAGATGTCCC -3'
(R):5'- TCCATCCTGAATGCACAAACAGGAG -3'

Sequencing Primer
(F):5'- GCTAAGATGTCCCTGCTCC -3'
(R):5'- GTGGGCAGAACCTAGACACTC -3'
Posted On2013-07-30