Incidental Mutation 'R0102:Ppp1r15b'
ID63270
Institutional Source Beutler Lab
Gene Symbol Ppp1r15b
Ensembl Gene ENSMUSG00000046062
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 15b
Synonyms1810033K10Rik, CReP, C530022L24Rik
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0102 (G1)
Quality Score207
Status Validated
Chromosome1
Chromosomal Location133131143-133139783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133133170 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 475 (N475S)
Ref Sequence ENSEMBL: ENSMUSP00000057062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052529]
Predicted Effect probably damaging
Transcript: ENSMUST00000052529
AA Change: N475S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057062
Gene: ENSMUSG00000046062
AA Change: N475S

DomainStartEndE-ValueType
Pfam:CReP_N 1 394 1.3e-205 PFAM
Pfam:PP1c_bdg 397 682 1.5e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195676
Meta Mutation Damage Score 0.2236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the protein coding ORF is expressed at high levels in response to stress. Continual translation of the mRNA under conditions of eukaryotic translation initiation factor 2A inactivation is thought to create a feedback loop for reactivation of the gene during recovery from stress. In addition, it has been shown that this protein plays a role in membrane traffic that is independent of translation and that it is required for exocytosis from erythroleukemia cells. Allelic variants of this gene are associated with microcephaly, short stature, and impaired glucose metabolism. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die within the first day after birth with decreased weight at birth and red blood cell counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Ppp1r15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Ppp1r15b APN 1 133132023 missense probably benign 0.15
IGL02803:Ppp1r15b APN 1 133133343 missense probably damaging 1.00
R0102:Ppp1r15b UTSW 1 133133170 missense probably damaging 1.00
R0565:Ppp1r15b UTSW 1 133136653 splice site probably benign
R1513:Ppp1r15b UTSW 1 133133350 missense probably benign 0.06
R1604:Ppp1r15b UTSW 1 133132549 missense probably benign 0.21
R1932:Ppp1r15b UTSW 1 133131625 start gained probably benign
R4084:Ppp1r15b UTSW 1 133133067 missense probably damaging 1.00
R4687:Ppp1r15b UTSW 1 133132135 missense probably benign 0.00
R5654:Ppp1r15b UTSW 1 133131644 start gained probably benign
R6181:Ppp1r15b UTSW 1 133132523 nonsense probably null
R8862:Ppp1r15b UTSW 1 133136768 missense probably damaging 1.00
RF018:Ppp1r15b UTSW 1 133131614 start gained probably benign
X0025:Ppp1r15b UTSW 1 133132300 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGAAGCCAGCTCTGATTCTGAAAG -3'
(R):5'- AGAAGGCCACTGTAGCCTCAGAAG -3'

Sequencing Primer
(F):5'- CAGCTCTGATTCTGAAAGTGAGG -3'
(R):5'- TCTTCCCTGACGGTTGAAAAG -3'
Posted On2013-07-30