Mutagenetix > Incidental Mutation

Incidental Mutation 'R8144:Mdga2'

632702

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

MMRRC Submission

067572-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8144 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66655263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 457 (I457T)

Ref Sequence

ENSEMBL: ENSMUSP00000046761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

AlphaFold

P60755

Predicted Effect

probably damaging
Transcript: ENSMUST00000037181
AA Change: I457T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: I457T

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: I447T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000222167
AA Change: I388T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223141
AA Change: I388T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.7%
3x: 99.4%
10x: 98.0%
20x: 90.8%

Validation Efficiency

96% (50/52)

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	C	9: 57,259,105		probably benign	Het
3110002H16Rik	A	T	18: 12,185,647		probably null	Het
4932415D10Rik	A	T	10: 82,294,599	L859*	probably null	Het
A2ml1	T	C	6: 128,569,999	D389G	possibly damaging	Het
Acy1	A	T	9: 106,436,120		probably null	Het
Adcy2	G	A	13: 68,734,635	Q328*	probably null	Het
Arhgef40	T	A	14: 51,998,175	V1171E	probably damaging	Het
Arrb1	G	A	7: 99,598,452		probably null	Het
Atxn1l	G	A	8: 109,732,601	A343V	probably benign	Het
C3	A	T	17: 57,226,276	V109E	probably damaging	Het
Clptm1	A	T	7: 19,633,902	V595E	possibly damaging	Het
Cpne6	T	C	14: 55,512,609	C66R	possibly damaging	Het
Dhrs3	T	C	4: 144,919,904	S175P	probably damaging	Het
Eif2b1	A	T	5: 124,573,145	M187K	probably damaging	Het
Eln	CTCCAGCTCCGAT	C	5: 134,729,149		probably benign	Het
Evc2	T	C	5: 37,380,567	L533P	probably damaging	Het
Fam221b	T	G	4: 43,665,465	Q331P	probably damaging	Het
Fam221b	G	T	4: 43,665,466	Q331K	probably benign	Het
Golga3	T	C	5: 110,185,879	V127A	probably damaging	Het
Itsn1	C	T	16: 91,912,005	P1719L	unknown	Het
Kdelc1	A	G	1: 44,110,806	Y408H	probably damaging	Het
Lars	T	G	18: 42,218,526	H871P	probably damaging	Het
Mamdc4	A	T	2: 25,567,007	V590E	probably damaging	Het
Morc2a	T	C	11: 3,684,039	V717A	probably benign	Het
Olfr406	C	A	11: 74,269,558	H56Q	probably damaging	Het
Olfr926	A	T	9: 38,877,366	L63F	probably damaging	Het
Pank4	A	T	4: 154,970,080	Q170L	probably benign	Het
Pde4dip	G	T	3: 97,715,426	A1489D	probably damaging	Het
Pde8b	A	T	13: 95,222,770	I15N	probably damaging	Het
Pex16	A	C	2: 92,375,640	E26A	probably damaging	Het
Polq	C	T	16: 37,029,484	P367S	probably benign	Het
Polr1a	T	A	6: 71,950,616	V817E	probably benign	Het
Pthlh	T	C	6: 147,257,165	D99G	probably damaging	Het
Rasgrp4	A	T	7: 29,149,117	S556C	probably damaging	Het
Rhobtb1	G	T	10: 69,289,558	V653L	possibly damaging	Het
Rin2	G	A	2: 145,822,305	R33Q	probably benign	Het
Sh3rf2	C	T	18: 42,141,059	T430I	probably benign	Het
Slc14a2	A	G	18: 78,184,544		probably null	Het
Slc39a8	C	T	3: 135,884,643	Q366*	probably null	Het
Tagln3	G	T	16: 45,724,191	A39D	probably benign	Het
Tfdp1	T	A	8: 13,373,015	C307S	probably benign	Het
Tlr11	T	C	14: 50,362,488	S644P	probably damaging	Het
Tnpo3	T	C	6: 29,558,762	D723G	probably benign	Het
Xpo5	A	G	17: 46,208,219	N195D	probably benign	Het
Zfp11	T	C	5: 129,656,630	Y589C	possibly damaging	Het
Zfp712	T	C	13: 67,041,108	T452A	probably benign	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8319:Mdga2	UTSW	12	67221029	missense	unknown
R8715:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R8977:Mdga2	UTSW	12	66797635	missense	possibly damaging	0.88
R9138:Mdga2	UTSW	12	66568889	missense	possibly damaging	0.89
R9177:Mdga2	UTSW	12	66470707	missense	possibly damaging	0.66
R9223:Mdga2	UTSW	12	66568860	missense	possibly damaging	0.81
R9248:Mdga2	UTSW	12	66689452	missense	possibly damaging	0.87
R9264:Mdga2	UTSW	12	66513283	missense	probably damaging	1.00
R9381:Mdga2	UTSW	12	66550530	missense	possibly damaging	0.64
R9456:Mdga2	UTSW	12	66568758	missense	probably benign	0.44
R9633:Mdga2	UTSW	12	66689432	missense	probably benign	0.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00
Z1186:Mdga2	UTSW	12	66568953	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GCAAGCCTCTTACCTGTACTGC -3'
(R):5'- AGACGACTACCTAAAGTGACCG -3'

Sequencing Primer
(F):5'- TCTTACCTGTACTGCTGGAAATG -3'
(R):5'- TCAAAATAACACTAACTCCTTGTGG -3'

Posted On

2020-06-30