Incidental Mutation 'R8144:Mdga2'
ID632702
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8144 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66655263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 457 (I457T)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: I457T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: I457T

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: I447T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: I388T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: I388T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 98.0%
  • 20x: 90.8%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,259,105 probably benign Het
3110002H16Rik A T 18: 12,185,647 probably null Het
4932415D10Rik A T 10: 82,294,599 L859* probably null Het
A2ml1 T C 6: 128,569,999 D389G possibly damaging Het
Acy1 A T 9: 106,436,120 probably null Het
Adcy2 G A 13: 68,734,635 Q328* probably null Het
Arhgef40 T A 14: 51,998,175 V1171E probably damaging Het
Arrb1 G A 7: 99,598,452 probably null Het
Atxn1l G A 8: 109,732,601 A343V probably benign Het
C3 A T 17: 57,226,276 V109E probably damaging Het
Clptm1 A T 7: 19,633,902 V595E possibly damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Dhrs3 T C 4: 144,919,904 S175P probably damaging Het
Eif2b1 A T 5: 124,573,145 M187K probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Evc2 T C 5: 37,380,567 L533P probably damaging Het
Fam221b T G 4: 43,665,465 Q331P probably damaging Het
Fam221b G T 4: 43,665,466 Q331K probably benign Het
Golga3 T C 5: 110,185,879 V127A probably damaging Het
Itsn1 C T 16: 91,912,005 P1719L unknown Het
Kdelc1 A G 1: 44,110,806 Y408H probably damaging Het
Lars T G 18: 42,218,526 H871P probably damaging Het
Mamdc4 A T 2: 25,567,007 V590E probably damaging Het
Morc2a T C 11: 3,684,039 V717A probably benign Het
Olfr406 C A 11: 74,269,558 H56Q probably damaging Het
Olfr926 A T 9: 38,877,366 L63F probably damaging Het
Pank4 A T 4: 154,970,080 Q170L probably benign Het
Pde4dip G T 3: 97,715,426 A1489D probably damaging Het
Pde8b A T 13: 95,222,770 I15N probably damaging Het
Pex16 A C 2: 92,375,640 E26A probably damaging Het
Polq C T 16: 37,029,484 P367S probably benign Het
Polr1a T A 6: 71,950,616 V817E probably benign Het
Pthlh T C 6: 147,257,165 D99G probably damaging Het
Rasgrp4 A T 7: 29,149,117 S556C probably damaging Het
Rhobtb1 G T 10: 69,289,558 V653L possibly damaging Het
Rin2 G A 2: 145,822,305 R33Q probably benign Het
Sh3rf2 C T 18: 42,141,059 T430I probably benign Het
Slc14a2 A G 18: 78,184,544 probably null Het
Slc39a8 C T 3: 135,884,643 Q366* probably null Het
Tagln3 G T 16: 45,724,191 A39D probably benign Het
Tfdp1 T A 8: 13,373,015 C307S probably benign Het
Tlr11 T C 14: 50,362,488 S644P probably damaging Het
Tnpo3 T C 6: 29,558,762 D723G probably benign Het
Xpo5 A G 17: 46,208,219 N195D probably benign Het
Zfp11 T C 5: 129,656,630 Y589C possibly damaging Het
Zfp712 T C 13: 67,041,108 T452A probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCCTCTTACCTGTACTGC -3'
(R):5'- AGACGACTACCTAAAGTGACCG -3'

Sequencing Primer
(F):5'- TCTTACCTGTACTGCTGGAAATG -3'
(R):5'- TCAAAATAACACTAACTCCTTGTGG -3'
Posted On2020-06-30