Incidental Mutation 'R8144:Lars'
ID632715
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8144 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 42218526 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 871 (H871P)
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590]
Predicted Effect probably damaging
Transcript: ENSMUST00000097590
AA Change: H871P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: H871P

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 98.0%
  • 20x: 90.8%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,259,105 probably benign Het
3110002H16Rik A T 18: 12,185,647 probably null Het
4932415D10Rik A T 10: 82,294,599 L859* probably null Het
A2ml1 T C 6: 128,569,999 D389G possibly damaging Het
Acy1 A T 9: 106,436,120 probably null Het
Adcy2 G A 13: 68,734,635 Q328* probably null Het
Arhgef40 T A 14: 51,998,175 V1171E probably damaging Het
Arrb1 G A 7: 99,598,452 probably null Het
Atxn1l G A 8: 109,732,601 A343V probably benign Het
C3 A T 17: 57,226,276 V109E probably damaging Het
Clptm1 A T 7: 19,633,902 V595E possibly damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Dhrs3 T C 4: 144,919,904 S175P probably damaging Het
Eif2b1 A T 5: 124,573,145 M187K probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Evc2 T C 5: 37,380,567 L533P probably damaging Het
Fam221b T G 4: 43,665,465 Q331P probably damaging Het
Fam221b G T 4: 43,665,466 Q331K probably benign Het
Golga3 T C 5: 110,185,879 V127A probably damaging Het
Itsn1 C T 16: 91,912,005 P1719L unknown Het
Kdelc1 A G 1: 44,110,806 Y408H probably damaging Het
Mamdc4 A T 2: 25,567,007 V590E probably damaging Het
Mdga2 A G 12: 66,655,263 I457T probably damaging Het
Morc2a T C 11: 3,684,039 V717A probably benign Het
Olfr406 C A 11: 74,269,558 H56Q probably damaging Het
Olfr926 A T 9: 38,877,366 L63F probably damaging Het
Pank4 A T 4: 154,970,080 Q170L probably benign Het
Pde4dip G T 3: 97,715,426 A1489D probably damaging Het
Pde8b A T 13: 95,222,770 I15N probably damaging Het
Pex16 A C 2: 92,375,640 E26A probably damaging Het
Polq C T 16: 37,029,484 P367S probably benign Het
Polr1a T A 6: 71,950,616 V817E probably benign Het
Pthlh T C 6: 147,257,165 D99G probably damaging Het
Rasgrp4 A T 7: 29,149,117 S556C probably damaging Het
Rhobtb1 G T 10: 69,289,558 V653L possibly damaging Het
Rin2 G A 2: 145,822,305 R33Q probably benign Het
Sh3rf2 C T 18: 42,141,059 T430I probably benign Het
Slc14a2 A G 18: 78,184,544 probably null Het
Slc39a8 C T 3: 135,884,643 Q366* probably null Het
Tagln3 G T 16: 45,724,191 A39D probably benign Het
Tfdp1 T A 8: 13,373,015 C307S probably benign Het
Tlr11 T C 14: 50,362,488 S644P probably damaging Het
Tnpo3 T C 6: 29,558,762 D723G probably benign Het
Xpo5 A G 17: 46,208,219 N195D probably benign Het
Zfp11 T C 5: 129,656,630 Y589C possibly damaging Het
Zfp712 T C 13: 67,041,108 T452A probably benign Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1583:Lars UTSW 18 42210050 missense probably damaging 1.00
R1584:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3733:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6249:Lars UTSW 18 42257206 splice site probably null
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
R7390:Lars UTSW 18 42210018 critical splice donor site probably null
R7451:Lars UTSW 18 42202550 missense probably benign 0.00
R7618:Lars UTSW 18 42244891 missense probably benign 0.10
R7831:Lars UTSW 18 42217562 missense probably benign 0.24
R7971:Lars UTSW 18 42218566 missense probably benign 0.06
R8003:Lars UTSW 18 42221619 missense probably damaging 1.00
R8082:Lars UTSW 18 42244910 missense probably damaging 0.98
R8181:Lars UTSW 18 42228770 missense probably damaging 0.98
R8196:Lars UTSW 18 42210101 missense possibly damaging 0.77
R8309:Lars UTSW 18 42243028 missense possibly damaging 0.54
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGCCCTATATATGCCAGG -3'
(R):5'- ACAGACTTCCTTCTTGACAATCG -3'

Sequencing Primer
(F):5'- CCTTTTTAACCACTGGAAGAACAG -3'
(R):5'- TCCTTAATGCATTAAAACCAAGAAAC -3'
Posted On2020-06-30