Incidental Mutation 'R8145:Tnc'
ID632731
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8145 (G1)
Quality Score173.009
Status Validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64017479 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 407 (Q407K)
Ref Sequence ENSEMBL: ENSMUSP00000030056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect probably benign
Transcript: ENSMUST00000030056
AA Change: Q407K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: Q407K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107371
AA Change: Q407K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364
AA Change: Q407K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107372
AA Change: Q407K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: Q407K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107377
AA Change: Q407K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: Q407K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,267 S3039P probably damaging Het
5430419D17Rik G T 7: 131,296,316 V2088L unknown Het
Alg6 A T 4: 99,746,327 D273V probably damaging Het
Ankk1 T A 9: 49,415,797 H694L possibly damaging Het
Asb7 G T 7: 66,659,948 N173K probably benign Het
Atp10b A T 11: 43,202,122 Q428L probably damaging Het
Bag3 A G 7: 128,545,888 E409G possibly damaging Het
Bpifb2 T A 2: 153,891,312 V398E probably damaging Het
Ccr6 T C 17: 8,256,113 V50A probably benign Het
Cdx1 T C 18: 61,019,923 N204D probably damaging Het
Ciao1 T C 2: 127,245,806 D203G possibly damaging Het
Cldn7 A T 11: 69,966,066 Y47F possibly damaging Het
Col6a1 A T 10: 76,723,471 D110E possibly damaging Het
Cpne6 C A 14: 55,514,568 Q261K probably benign Het
Crebbp T C 16: 4,128,525 T497A probably benign Het
Cyp2s1 A G 7: 25,808,042 probably null Het
Ddx42 A T 11: 106,240,061 I454F possibly damaging Het
Ddx5 G T 11: 106,782,085 A538E probably benign Het
Dnajb1 T A 8: 83,610,315 V238D probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Eif4b A G 15: 102,092,988 T437A unknown Het
Eppk1 T C 15: 76,106,700 T1994A possibly damaging Het
Fbxw15 A T 9: 109,555,590 C381S probably benign Het
Fosl2 T A 5: 32,153,068 V287D probably damaging Het
Gdpd4 A G 7: 98,040,870 T590A probably benign Het
Gm20075 A T 13: 96,081,141 D63E probably benign Het
Gm21994 T C 2: 150,254,535 K325E probably benign Het
Gm49368 A G 7: 128,113,315 E877G probably null Het
Grin2b C T 6: 135,732,499 A1350T probably benign Het
Gzmk A G 13: 113,171,896 L257P probably damaging Het
Has2 T A 15: 56,681,779 K142N probably benign Het
Hectd1 T C 12: 51,784,233 E944G possibly damaging Het
Hmcn1 T C 1: 150,753,660 R949G probably benign Het
Hmcn2 A G 2: 31,423,105 E3442G probably damaging Het
Irf9 T A 14: 55,605,798 C152* probably null Het
Itga3 A G 11: 95,052,464 W936R probably damaging Het
Klhl11 G T 11: 100,463,914 D360E probably damaging Het
Lnx1 G A 5: 74,685,399 T130I probably benign Het
Lrrc36 C T 8: 105,443,764 P82L probably damaging Het
Map4k4 T C 1: 40,000,534 C29R Het
Mki67 T C 7: 135,694,336 K2990E probably benign Het
Mnt G A 11: 74,842,973 A477T unknown Het
Mroh9 A G 1: 163,062,527 S214P probably benign Het
Mrps18b C A 17: 35,914,401 R94L possibly damaging Het
Myh6 T A 14: 54,953,925 I820F probably benign Het
Nphp3 A G 9: 104,035,851 T943A probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr559 C A 7: 102,723,730 L253F probably damaging Het
Papolb T C 5: 142,528,598 D430G probably benign Het
Pdzd2 T C 15: 12,407,372 H334R probably benign Het
Pkd1l2 T A 8: 117,055,003 M768L probably benign Het
Pklr G T 3: 89,145,488 R547L probably benign Het
Pla2g4a T C 1: 149,840,643 Y697C probably benign Het
Prkcd T C 14: 30,602,062 T435A probably benign Het
Rfx1 C T 8: 84,074,028 P86L probably benign Het
Rnf19b C A 4: 129,084,069 A693D probably benign Het
Scn9a A G 2: 66,487,410 I1578T probably damaging Het
Slamf9 A G 1: 172,476,375 S96G probably benign Het
Slc17a8 T C 10: 89,576,371 D584G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc2a7 C A 4: 150,168,361 T486K probably damaging Het
Slc6a20a G A 9: 123,637,000 A592V probably damaging Het
Spz1 T C 13: 92,575,101 D289G probably benign Het
Sspo G A 6: 48,467,749 C2226Y possibly damaging Het
Taf4b T G 18: 14,830,028 D608E probably damaging Het
Tagap1 A T 17: 6,956,127 I390N probably damaging Het
Tcp11l2 A G 10: 84,608,616 N430D probably damaging Het
Thsd7b T C 1: 129,760,299 L649P probably damaging Het
Tmprss15 C T 16: 78,960,585 G956R probably damaging Het
Tti1 C A 2: 158,007,589 E577* probably null Het
Vmn2r79 A T 7: 87,037,654 M748L probably benign Het
Zbtb37 C T 1: 161,020,084 R451Q probably damaging Het
Zfp566 A T 7: 30,078,360 I132N probably benign Het
Zik1 C T 7: 10,490,003 G389E probably damaging Het
Zzef1 A T 11: 72,908,469 K2382* probably null Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
BB009:Tnc UTSW 4 64008620 missense probably benign
BB019:Tnc UTSW 4 64008620 missense probably benign
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 splice site probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
R7932:Tnc UTSW 4 64008620 missense probably benign
R7947:Tnc UTSW 4 64017343 missense probably damaging 1.00
R7974:Tnc UTSW 4 64000724 missense possibly damaging 0.84
R7991:Tnc UTSW 4 64008746 missense probably benign 0.42
R8004:Tnc UTSW 4 63984657 missense probably benign 0.04
R8080:Tnc UTSW 4 63976469 missense possibly damaging 0.52
R8109:Tnc UTSW 4 64008763 missense probably benign 0.11
R8340:Tnc UTSW 4 64007799 missense probably damaging 1.00
R8360:Tnc UTSW 4 63967274 missense probably benign 0.00
R8671:Tnc UTSW 4 64017446 missense probably damaging 1.00
R8691:Tnc UTSW 4 63962076 missense probably damaging 1.00
R8759:Tnc UTSW 4 64006264 missense possibly damaging 0.86
R8864:Tnc UTSW 4 63993059 missense probably damaging 0.98
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Z1177:Tnc UTSW 4 63960544 critical splice acceptor site probably null
Z1177:Tnc UTSW 4 64007426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCCTTGAAGCCTTGTTC -3'
(R):5'- GCACCTGCTACTGTGAAGAAG -3'

Sequencing Primer
(F):5'- GAAGCCTTGTTCACATATGCAC -3'
(R):5'- CCTGCTACTGTGAAGAAGGTTTC -3'
Posted On2020-06-30