Mutagenetix > Incidental Mutation

Incidental Mutation 'R8145:Grin2b'

632740

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8145 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135732499 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1350 (A1350T)

Ref Sequence

ENSEMBL: ENSMUSP00000062284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: A1350T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: A1350T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: A1350T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: A1350T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Coding Region Coverage

1x: 99.7%
3x: 99.5%
10x: 97.9%
20x: 90.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,998,267	S3039P	probably damaging	Het
5430419D17Rik	G	T	7: 131,296,316	V2088L	unknown	Het
Alg6	A	T	4: 99,746,327	D273V	probably damaging	Het
Ankk1	T	A	9: 49,415,797	H694L	possibly damaging	Het
Asb7	G	T	7: 66,659,948	N173K	probably benign	Het
Atp10b	A	T	11: 43,202,122	Q428L	probably damaging	Het
Bag3	A	G	7: 128,545,888	E409G	possibly damaging	Het
Bpifb2	T	A	2: 153,891,312	V398E	probably damaging	Het
Ccr6	T	C	17: 8,256,113	V50A	probably benign	Het
Cdx1	T	C	18: 61,019,923	N204D	probably damaging	Het
Ciao1	T	C	2: 127,245,806	D203G	possibly damaging	Het
Cldn7	A	T	11: 69,966,066	Y47F	possibly damaging	Het
Col6a1	A	T	10: 76,723,471	D110E	possibly damaging	Het
Cpne6	C	A	14: 55,514,568	Q261K	probably benign	Het
Crebbp	T	C	16: 4,128,525	T497A	probably benign	Het
Cyp2s1	A	G	7: 25,808,042		probably null	Het
Ddx42	A	T	11: 106,240,061	I454F	possibly damaging	Het
Ddx5	G	T	11: 106,782,085	A538E	probably benign	Het
Dnajb1	T	A	8: 83,610,315	V238D	probably damaging	Het
Dntt	A	G	19: 41,055,785	Y463C	probably damaging	Het
Eif4b	A	G	15: 102,092,988	T437A	unknown	Het
Eppk1	T	C	15: 76,106,700	T1994A	possibly damaging	Het
Fbxw15	A	T	9: 109,555,590	C381S	probably benign	Het
Fosl2	T	A	5: 32,153,068	V287D	probably damaging	Het
Gdpd4	A	G	7: 98,040,870	T590A	probably benign	Het
Gm20075	A	T	13: 96,081,141	D63E	probably benign	Het
Gm21994	T	C	2: 150,254,535	K325E	probably benign	Het
Gm49368	A	G	7: 128,113,315	E877G	probably null	Het
Gzmk	A	G	13: 113,171,896	L257P	probably damaging	Het
Has2	T	A	15: 56,681,779	K142N	probably benign	Het
Hectd1	T	C	12: 51,784,233	E944G	possibly damaging	Het
Hmcn1	T	C	1: 150,753,660	R949G	probably benign	Het
Hmcn2	A	G	2: 31,423,105	E3442G	probably damaging	Het
Irf9	T	A	14: 55,605,798	C152*	probably null	Het
Itga3	A	G	11: 95,052,464	W936R	probably damaging	Het
Klhl11	G	T	11: 100,463,914	D360E	probably damaging	Het
Lnx1	G	A	5: 74,685,399	T130I	probably benign	Het
Lrrc36	C	T	8: 105,443,764	P82L	probably damaging	Het
Map4k4	T	C	1: 40,000,534	C29R		Het
Mki67	T	C	7: 135,694,336	K2990E	probably benign	Het
Mnt	G	A	11: 74,842,973	A477T	unknown	Het
Mroh9	A	G	1: 163,062,527	S214P	probably benign	Het
Mrps18b	C	A	17: 35,914,401	R94L	possibly damaging	Het
Myh6	T	A	14: 54,953,925	I820F	probably benign	Het
Nphp3	A	G	9: 104,035,851	T943A	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Olfr559	C	A	7: 102,723,730	L253F	probably damaging	Het
Papolb	T	C	5: 142,528,598	D430G	probably benign	Het
Pdzd2	T	C	15: 12,407,372	H334R	probably benign	Het
Pkd1l2	T	A	8: 117,055,003	M768L	probably benign	Het
Pklr	G	T	3: 89,145,488	R547L	probably benign	Het
Pla2g4a	T	C	1: 149,840,643	Y697C	probably benign	Het
Prkcd	T	C	14: 30,602,062	T435A	probably benign	Het
Rfx1	C	T	8: 84,074,028	P86L	probably benign	Het
Rnf19b	C	A	4: 129,084,069	A693D	probably benign	Het
Scn9a	A	G	2: 66,487,410	I1578T	probably damaging	Het
Slamf9	A	G	1: 172,476,375	S96G	probably benign	Het
Slc17a8	T	C	10: 89,576,371	D584G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc2a7	C	A	4: 150,168,361	T486K	probably damaging	Het
Slc6a20a	G	A	9: 123,637,000	A592V	probably damaging	Het
Spz1	T	C	13: 92,575,101	D289G	probably benign	Het
Sspo	G	A	6: 48,467,749	C2226Y	possibly damaging	Het
Taf4b	T	G	18: 14,830,028	D608E	probably damaging	Het
Tagap1	A	T	17: 6,956,127	I390N	probably damaging	Het
Tcp11l2	A	G	10: 84,608,616	N430D	probably damaging	Het
Thsd7b	T	C	1: 129,760,299	L649P	probably damaging	Het
Tmprss15	C	T	16: 78,960,585	G956R	probably damaging	Het
Tnc	G	T	4: 64,017,479	Q407K	probably benign	Het
Tti1	C	A	2: 158,007,589	E577*	probably null	Het
Vmn2r79	A	T	7: 87,037,654	M748L	probably benign	Het
Zbtb37	C	T	1: 161,020,084	R451Q	probably damaging	Het
Zfp566	A	T	7: 30,078,360	I132N	probably benign	Het
Zik1	C	T	7: 10,490,003	G389E	probably damaging	Het
Zzef1	A	T	11: 72,908,469	K2382*	probably null	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCCTGAAGAAGTAGGATTTGC -3'
(R):5'- CTGTGGCTGTGTCATCCAAC -3'

Sequencing Primer
(F):5'- CTGAAGAAGTAGGATTTGCTGCCG -3'
(R):5'- GTATCCTCAAAGCCCGACTAATTC -3'

Posted On

2020-06-30