Incidental Mutation 'R8145:Grin2b'
ID 632740
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 067573-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8145 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 135709497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1350 (A1350T)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053880
AA Change: A1350T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: A1350T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111905
AA Change: A1350T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: A1350T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg6 A T 4: 99,634,564 (GRCm39) D273V probably damaging Het
Ankk1 T A 9: 49,327,097 (GRCm39) H694L possibly damaging Het
Asb7 G T 7: 66,309,696 (GRCm39) N173K probably benign Het
Atp10b A T 11: 43,092,949 (GRCm39) Q428L probably damaging Het
Bag3 A G 7: 128,147,612 (GRCm39) E409G possibly damaging Het
Bltp1 T C 3: 37,052,416 (GRCm39) S3039P probably damaging Het
Bpifb2 T A 2: 153,733,232 (GRCm39) V398E probably damaging Het
Btf3l4b A T 13: 96,217,649 (GRCm39) D63E probably benign Het
Ccr6 T C 17: 8,474,945 (GRCm39) V50A probably benign Het
Cdcp3 G T 7: 130,898,045 (GRCm39) V2088L unknown Het
Cdx1 T C 18: 61,152,995 (GRCm39) N204D probably damaging Het
Ciao1 T C 2: 127,087,726 (GRCm39) D203G possibly damaging Het
Cldn7 A T 11: 69,856,892 (GRCm39) Y47F possibly damaging Het
Col6a1 A T 10: 76,559,305 (GRCm39) D110E possibly damaging Het
Cpne6 C A 14: 55,752,025 (GRCm39) Q261K probably benign Het
Crebbp T C 16: 3,946,389 (GRCm39) T497A probably benign Het
Cyp2s1 A G 7: 25,507,467 (GRCm39) probably null Het
Ddx42 A T 11: 106,130,887 (GRCm39) I454F possibly damaging Het
Ddx5 G T 11: 106,672,911 (GRCm39) A538E probably benign Het
Dnajb1 T A 8: 84,336,944 (GRCm39) V238D probably damaging Het
Dntt A G 19: 41,044,224 (GRCm39) Y463C probably damaging Het
Eif4b A G 15: 102,001,423 (GRCm39) T437A unknown Het
Eppk1 T C 15: 75,990,900 (GRCm39) T1994A possibly damaging Het
Fbxw15 A T 9: 109,384,658 (GRCm39) C381S probably benign Het
Fosl2 T A 5: 32,310,412 (GRCm39) V287D probably damaging Het
Gdpd4 A G 7: 97,690,077 (GRCm39) T590A probably benign Het
Gm49368 A G 7: 127,712,487 (GRCm39) E877G probably null Het
Gzmk A G 13: 113,308,430 (GRCm39) L257P probably damaging Het
Has2 T A 15: 56,545,175 (GRCm39) K142N probably benign Het
Hectd1 T C 12: 51,831,016 (GRCm39) E944G possibly damaging Het
Hmcn1 T C 1: 150,629,411 (GRCm39) R949G probably benign Het
Hmcn2 A G 2: 31,313,117 (GRCm39) E3442G probably damaging Het
Irf9 T A 14: 55,843,255 (GRCm39) C152* probably null Het
Itga3 A G 11: 94,943,290 (GRCm39) W936R probably damaging Het
Klhl11 G T 11: 100,354,740 (GRCm39) D360E probably damaging Het
Lnx1 G A 5: 74,846,060 (GRCm39) T130I probably benign Het
Lrrc36 C T 8: 106,170,396 (GRCm39) P82L probably damaging Het
Map4k4 T C 1: 40,039,694 (GRCm39) C29R Het
Mki67 T C 7: 135,296,065 (GRCm39) K2990E probably benign Het
Mnt G A 11: 74,733,799 (GRCm39) A477T unknown Het
Mroh9 A G 1: 162,890,096 (GRCm39) S214P probably benign Het
Mrps18b C A 17: 36,225,293 (GRCm39) R94L possibly damaging Het
Myh6 T A 14: 55,191,382 (GRCm39) I820F probably benign Het
Nphp3 A G 9: 103,913,050 (GRCm39) T943A probably benign Het
Or51a25 C A 7: 102,372,937 (GRCm39) L253F probably damaging Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Papolb T C 5: 142,514,353 (GRCm39) D430G probably benign Het
Pdzd2 T C 15: 12,407,458 (GRCm39) H334R probably benign Het
Pkd1l2 T A 8: 117,781,742 (GRCm39) M768L probably benign Het
Pklr G T 3: 89,052,795 (GRCm39) R547L probably benign Het
Pla2g4a T C 1: 149,716,394 (GRCm39) Y697C probably benign Het
Prkcd T C 14: 30,324,019 (GRCm39) T435A probably benign Het
Rfx1 C T 8: 84,800,657 (GRCm39) P86L probably benign Het
Rnf19b C A 4: 128,977,862 (GRCm39) A693D probably benign Het
Scn9a A G 2: 66,317,754 (GRCm39) I1578T probably damaging Het
Slamf9 A G 1: 172,303,942 (GRCm39) S96G probably benign Het
Slc17a8 T C 10: 89,412,233 (GRCm39) D584G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc2a7 C A 4: 150,252,818 (GRCm39) T486K probably damaging Het
Slc6a20a G A 9: 123,466,065 (GRCm39) A592V probably damaging Het
Spz1 T C 13: 92,711,609 (GRCm39) D289G probably benign Het
Sspo G A 6: 48,444,683 (GRCm39) C2226Y possibly damaging Het
Taf4b T G 18: 14,963,085 (GRCm39) D608E probably damaging Het
Tagap1 A T 17: 7,223,526 (GRCm39) I390N probably damaging Het
Tcp11l2 A G 10: 84,444,480 (GRCm39) N430D probably damaging Het
Thsd7b T C 1: 129,688,036 (GRCm39) L649P probably damaging Het
Tmprss15 C T 16: 78,757,473 (GRCm39) G956R probably damaging Het
Tnc G T 4: 63,935,716 (GRCm39) Q407K probably benign Het
Tti1 C A 2: 157,849,509 (GRCm39) E577* probably null Het
Vmn2r79 A T 7: 86,686,862 (GRCm39) M748L probably benign Het
Zbtb37 C T 1: 160,847,654 (GRCm39) R451Q probably damaging Het
Zfp1002 T C 2: 150,096,455 (GRCm39) K325E probably benign Het
Zfp566 A T 7: 29,777,785 (GRCm39) I132N probably benign Het
Zik1 C T 7: 10,223,930 (GRCm39) G389E probably damaging Het
Zzef1 A T 11: 72,799,295 (GRCm39) K2382* probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCCTGAAGAAGTAGGATTTGC -3'
(R):5'- CTGTGGCTGTGTCATCCAAC -3'

Sequencing Primer
(F):5'- CTGAAGAAGTAGGATTTGCTGCCG -3'
(R):5'- GTATCCTCAAAGCCCGACTAATTC -3'
Posted On 2020-06-30