Incidental Mutation 'R0102:Olfr1216'
ID63276
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0102 (G1)
Quality Score127
Status Validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89013671 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 131 (Y131C)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably damaging
Transcript: ENSMUST00000099800
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: Y131C

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216000
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217000
AA Change: Y131C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Meta Mutation Damage Score 0.5523 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8243:Olfr1216 UTSW 2 89013707 missense probably benign 0.39
R8752:Olfr1216 UTSW 2 89013887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATGAGTGTCCGTGCAGGCCAG -3'
(R):5'- TGTGGTGACCATCATCTACAGCCC -3'

Sequencing Primer
(F):5'- AGGCCAGCTTCAGCAATG -3'
(R):5'- ATCATCTACAGCCCTGCACTG -3'
Posted On2013-07-30