Incidental Mutation 'R8145:Ddx42'
ID 632768
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene Name DEAD box helicase 42
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, B430002H05Rik, 1810047H21Rik, SF3b125
MMRRC Submission 067573-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8145 (G1)
Quality Score 210.009
Status Validated
Chromosome 11
Chromosomal Location 106107752-106139965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106130887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 454 (I454F)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
AlphaFold Q810A7
Predicted Effect possibly damaging
Transcript: ENSMUST00000021046
AA Change: I454F

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: I454F

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg6 A T 4: 99,634,564 (GRCm39) D273V probably damaging Het
Ankk1 T A 9: 49,327,097 (GRCm39) H694L possibly damaging Het
Asb7 G T 7: 66,309,696 (GRCm39) N173K probably benign Het
Atp10b A T 11: 43,092,949 (GRCm39) Q428L probably damaging Het
Bag3 A G 7: 128,147,612 (GRCm39) E409G possibly damaging Het
Bltp1 T C 3: 37,052,416 (GRCm39) S3039P probably damaging Het
Bpifb2 T A 2: 153,733,232 (GRCm39) V398E probably damaging Het
Btf3l4b A T 13: 96,217,649 (GRCm39) D63E probably benign Het
Ccr6 T C 17: 8,474,945 (GRCm39) V50A probably benign Het
Cdcp3 G T 7: 130,898,045 (GRCm39) V2088L unknown Het
Cdx1 T C 18: 61,152,995 (GRCm39) N204D probably damaging Het
Ciao1 T C 2: 127,087,726 (GRCm39) D203G possibly damaging Het
Cldn7 A T 11: 69,856,892 (GRCm39) Y47F possibly damaging Het
Col6a1 A T 10: 76,559,305 (GRCm39) D110E possibly damaging Het
Cpne6 C A 14: 55,752,025 (GRCm39) Q261K probably benign Het
Crebbp T C 16: 3,946,389 (GRCm39) T497A probably benign Het
Cyp2s1 A G 7: 25,507,467 (GRCm39) probably null Het
Ddx5 G T 11: 106,672,911 (GRCm39) A538E probably benign Het
Dnajb1 T A 8: 84,336,944 (GRCm39) V238D probably damaging Het
Dntt A G 19: 41,044,224 (GRCm39) Y463C probably damaging Het
Eif4b A G 15: 102,001,423 (GRCm39) T437A unknown Het
Eppk1 T C 15: 75,990,900 (GRCm39) T1994A possibly damaging Het
Fbxw15 A T 9: 109,384,658 (GRCm39) C381S probably benign Het
Fosl2 T A 5: 32,310,412 (GRCm39) V287D probably damaging Het
Gdpd4 A G 7: 97,690,077 (GRCm39) T590A probably benign Het
Gm49368 A G 7: 127,712,487 (GRCm39) E877G probably null Het
Grin2b C T 6: 135,709,497 (GRCm39) A1350T probably benign Het
Gzmk A G 13: 113,308,430 (GRCm39) L257P probably damaging Het
Has2 T A 15: 56,545,175 (GRCm39) K142N probably benign Het
Hectd1 T C 12: 51,831,016 (GRCm39) E944G possibly damaging Het
Hmcn1 T C 1: 150,629,411 (GRCm39) R949G probably benign Het
Hmcn2 A G 2: 31,313,117 (GRCm39) E3442G probably damaging Het
Irf9 T A 14: 55,843,255 (GRCm39) C152* probably null Het
Itga3 A G 11: 94,943,290 (GRCm39) W936R probably damaging Het
Klhl11 G T 11: 100,354,740 (GRCm39) D360E probably damaging Het
Lnx1 G A 5: 74,846,060 (GRCm39) T130I probably benign Het
Lrrc36 C T 8: 106,170,396 (GRCm39) P82L probably damaging Het
Map4k4 T C 1: 40,039,694 (GRCm39) C29R Het
Mki67 T C 7: 135,296,065 (GRCm39) K2990E probably benign Het
Mnt G A 11: 74,733,799 (GRCm39) A477T unknown Het
Mroh9 A G 1: 162,890,096 (GRCm39) S214P probably benign Het
Mrps18b C A 17: 36,225,293 (GRCm39) R94L possibly damaging Het
Myh6 T A 14: 55,191,382 (GRCm39) I820F probably benign Het
Nphp3 A G 9: 103,913,050 (GRCm39) T943A probably benign Het
Or51a25 C A 7: 102,372,937 (GRCm39) L253F probably damaging Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Papolb T C 5: 142,514,353 (GRCm39) D430G probably benign Het
Pdzd2 T C 15: 12,407,458 (GRCm39) H334R probably benign Het
Pkd1l2 T A 8: 117,781,742 (GRCm39) M768L probably benign Het
Pklr G T 3: 89,052,795 (GRCm39) R547L probably benign Het
Pla2g4a T C 1: 149,716,394 (GRCm39) Y697C probably benign Het
Prkcd T C 14: 30,324,019 (GRCm39) T435A probably benign Het
Rfx1 C T 8: 84,800,657 (GRCm39) P86L probably benign Het
Rnf19b C A 4: 128,977,862 (GRCm39) A693D probably benign Het
Scn9a A G 2: 66,317,754 (GRCm39) I1578T probably damaging Het
Slamf9 A G 1: 172,303,942 (GRCm39) S96G probably benign Het
Slc17a8 T C 10: 89,412,233 (GRCm39) D584G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc2a7 C A 4: 150,252,818 (GRCm39) T486K probably damaging Het
Slc6a20a G A 9: 123,466,065 (GRCm39) A592V probably damaging Het
Spz1 T C 13: 92,711,609 (GRCm39) D289G probably benign Het
Sspo G A 6: 48,444,683 (GRCm39) C2226Y possibly damaging Het
Taf4b T G 18: 14,963,085 (GRCm39) D608E probably damaging Het
Tagap1 A T 17: 7,223,526 (GRCm39) I390N probably damaging Het
Tcp11l2 A G 10: 84,444,480 (GRCm39) N430D probably damaging Het
Thsd7b T C 1: 129,688,036 (GRCm39) L649P probably damaging Het
Tmprss15 C T 16: 78,757,473 (GRCm39) G956R probably damaging Het
Tnc G T 4: 63,935,716 (GRCm39) Q407K probably benign Het
Tti1 C A 2: 157,849,509 (GRCm39) E577* probably null Het
Vmn2r79 A T 7: 86,686,862 (GRCm39) M748L probably benign Het
Zbtb37 C T 1: 160,847,654 (GRCm39) R451Q probably damaging Het
Zfp1002 T C 2: 150,096,455 (GRCm39) K325E probably benign Het
Zfp566 A T 7: 29,777,785 (GRCm39) I132N probably benign Het
Zik1 C T 7: 10,223,930 (GRCm39) G389E probably damaging Het
Zzef1 A T 11: 72,799,295 (GRCm39) K2382* probably null Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106,126,575 (GRCm39) missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106,122,004 (GRCm39) missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106,138,325 (GRCm39) missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106,138,855 (GRCm39) missense probably benign 0.00
IGL01715:Ddx42 APN 11 106,115,101 (GRCm39) missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106,129,986 (GRCm39) missense probably benign 0.00
IGL03182:Ddx42 APN 11 106,138,353 (GRCm39) missense probably benign
P0045:Ddx42 UTSW 11 106,122,098 (GRCm39) missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106,138,675 (GRCm39) missense probably benign 0.03
R0646:Ddx42 UTSW 11 106,123,659 (GRCm39) missense probably benign 0.00
R2277:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106,121,976 (GRCm39) missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106,136,155 (GRCm39) missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106,138,636 (GRCm39) missense probably benign 0.00
R3498:Ddx42 UTSW 11 106,122,019 (GRCm39) missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106,138,518 (GRCm39) missense probably benign 0.03
R4421:Ddx42 UTSW 11 106,121,964 (GRCm39) missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106,138,529 (GRCm39) missense probably benign 0.09
R4953:Ddx42 UTSW 11 106,133,766 (GRCm39) missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106,115,724 (GRCm39) missense probably benign
R5669:Ddx42 UTSW 11 106,132,645 (GRCm39) missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106,125,796 (GRCm39) missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106,130,843 (GRCm39) missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106,119,646 (GRCm39) missense probably benign 0.14
R6991:Ddx42 UTSW 11 106,129,970 (GRCm39) missense probably damaging 1.00
R7351:Ddx42 UTSW 11 106,138,508 (GRCm39) missense probably benign
R7502:Ddx42 UTSW 11 106,138,565 (GRCm39) missense probably benign 0.00
R7792:Ddx42 UTSW 11 106,127,822 (GRCm39) missense probably damaging 1.00
R8425:Ddx42 UTSW 11 106,138,550 (GRCm39) missense probably benign
R9265:Ddx42 UTSW 11 106,132,435 (GRCm39) missense probably benign 0.01
R9523:Ddx42 UTSW 11 106,132,606 (GRCm39) missense probably benign 0.40
R9681:Ddx42 UTSW 11 106,125,679 (GRCm39) missense probably damaging 1.00
RF018:Ddx42 UTSW 11 106,123,630 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAACCATTATGGCAACTCATTTC -3'
(R):5'- TCAATCATCTGTGCCACTCGTG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CTAGTTCCAGGGGATCCAATACTG -3'
Posted On 2020-06-30