Incidental Mutation 'R8145:Cpne6'
ID632776
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R8145 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55514568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 261 (Q261K)
Ref Sequence ENSEMBL: ENSMUSP00000073847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062232] [ENSMUST00000074225] [ENSMUST00000111404] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643] [ENSMUST00000178694]
Predicted Effect probably benign
Transcript: ENSMUST00000062232
SMART Domains Protein: ENSMUSP00000054457
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 101 7.3e-18 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074225
AA Change: Q261K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: Q261K

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111404
SMART Domains Protein: ENSMUSP00000107035
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163767
AA Change: Q261K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: Q261K

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165262
AA Change: Q261K

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: Q261K

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165725
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171643
AA Change: Q261K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: Q261K

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178694
SMART Domains Protein: ENSMUSP00000136445
Gene: ENSMUSG00000040632

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
Pfam:Maf_N 67 102 2e-15 PFAM
BRLZ 157 221 1.6e-4 SMART
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,267 S3039P probably damaging Het
5430419D17Rik G T 7: 131,296,316 V2088L unknown Het
Alg6 A T 4: 99,746,327 D273V probably damaging Het
Ankk1 T A 9: 49,415,797 H694L possibly damaging Het
Asb7 G T 7: 66,659,948 N173K probably benign Het
Atp10b A T 11: 43,202,122 Q428L probably damaging Het
Bag3 A G 7: 128,545,888 E409G possibly damaging Het
Bpifb2 T A 2: 153,891,312 V398E probably damaging Het
Ccr6 T C 17: 8,256,113 V50A probably benign Het
Cdx1 T C 18: 61,019,923 N204D probably damaging Het
Ciao1 T C 2: 127,245,806 D203G possibly damaging Het
Cldn7 A T 11: 69,966,066 Y47F possibly damaging Het
Col6a1 A T 10: 76,723,471 D110E possibly damaging Het
Crebbp T C 16: 4,128,525 T497A probably benign Het
Cyp2s1 A G 7: 25,808,042 probably null Het
Ddx42 A T 11: 106,240,061 I454F possibly damaging Het
Ddx5 G T 11: 106,782,085 A538E probably benign Het
Dnajb1 T A 8: 83,610,315 V238D probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Eif4b A G 15: 102,092,988 T437A unknown Het
Eppk1 T C 15: 76,106,700 T1994A possibly damaging Het
Fbxw15 A T 9: 109,555,590 C381S probably benign Het
Fosl2 T A 5: 32,153,068 V287D probably damaging Het
Gdpd4 A G 7: 98,040,870 T590A probably benign Het
Gm20075 A T 13: 96,081,141 D63E probably benign Het
Gm21994 T C 2: 150,254,535 K325E probably benign Het
Gm49368 A G 7: 128,113,315 E877G probably null Het
Grin2b C T 6: 135,732,499 A1350T probably benign Het
Gzmk A G 13: 113,171,896 L257P probably damaging Het
Has2 T A 15: 56,681,779 K142N probably benign Het
Hectd1 T C 12: 51,784,233 E944G possibly damaging Het
Hmcn1 T C 1: 150,753,660 R949G probably benign Het
Hmcn2 A G 2: 31,423,105 E3442G probably damaging Het
Irf9 T A 14: 55,605,798 C152* probably null Het
Itga3 A G 11: 95,052,464 W936R probably damaging Het
Klhl11 G T 11: 100,463,914 D360E probably damaging Het
Lnx1 G A 5: 74,685,399 T130I probably benign Het
Lrrc36 C T 8: 105,443,764 P82L probably damaging Het
Map4k4 T C 1: 40,000,534 C29R Het
Mki67 T C 7: 135,694,336 K2990E probably benign Het
Mnt G A 11: 74,842,973 A477T unknown Het
Mroh9 A G 1: 163,062,527 S214P probably benign Het
Mrps18b C A 17: 35,914,401 R94L possibly damaging Het
Myh6 T A 14: 54,953,925 I820F probably benign Het
Nphp3 A G 9: 104,035,851 T943A probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr559 C A 7: 102,723,730 L253F probably damaging Het
Papolb T C 5: 142,528,598 D430G probably benign Het
Pdzd2 T C 15: 12,407,372 H334R probably benign Het
Pkd1l2 T A 8: 117,055,003 M768L probably benign Het
Pklr G T 3: 89,145,488 R547L probably benign Het
Pla2g4a T C 1: 149,840,643 Y697C probably benign Het
Prkcd T C 14: 30,602,062 T435A probably benign Het
Rfx1 C T 8: 84,074,028 P86L probably benign Het
Rnf19b C A 4: 129,084,069 A693D probably benign Het
Scn9a A G 2: 66,487,410 I1578T probably damaging Het
Slamf9 A G 1: 172,476,375 S96G probably benign Het
Slc17a8 T C 10: 89,576,371 D584G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc2a7 C A 4: 150,168,361 T486K probably damaging Het
Slc6a20a G A 9: 123,637,000 A592V probably damaging Het
Spz1 T C 13: 92,575,101 D289G probably benign Het
Sspo G A 6: 48,467,749 C2226Y possibly damaging Het
Taf4b T G 18: 14,830,028 D608E probably damaging Het
Tagap1 A T 17: 6,956,127 I390N probably damaging Het
Tcp11l2 A G 10: 84,608,616 N430D probably damaging Het
Thsd7b T C 1: 129,760,299 L649P probably damaging Het
Tmprss15 C T 16: 78,960,585 G956R probably damaging Het
Tnc G T 4: 64,017,479 Q407K probably benign Het
Tti1 C A 2: 158,007,589 E577* probably null Het
Vmn2r79 A T 7: 87,037,654 M748L probably benign Het
Zbtb37 C T 1: 161,020,084 R451Q probably damaging Het
Zfp566 A T 7: 30,078,360 I132N probably benign Het
Zik1 C T 7: 10,490,003 G389E probably damaging Het
Zzef1 A T 11: 72,908,469 K2382* probably null Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1472:Cpne6 UTSW 14 55514635 missense probably benign 0.00
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4453:Cpne6 UTSW 14 55512597 missense probably damaging 1.00
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5243:Cpne6 UTSW 14 55512747 missense probably damaging 1.00
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6475:Cpne6 UTSW 14 55513653 missense probably damaging 1.00
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R6787:Cpne6 UTSW 14 55515244 missense probably damaging 1.00
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
R7707:Cpne6 UTSW 14 55516314 missense probably damaging 1.00
R7934:Cpne6 UTSW 14 55512609 missense possibly damaging 0.74
R7935:Cpne6 UTSW 14 55512609 missense possibly damaging 0.74
R7998:Cpne6 UTSW 14 55516294 missense probably damaging 0.98
R8083:Cpne6 UTSW 14 55513241 missense probably benign 0.42
R8141:Cpne6 UTSW 14 55512609 missense possibly damaging 0.74
R8144:Cpne6 UTSW 14 55512609 missense possibly damaging 0.74
R8190:Cpne6 UTSW 14 55512028 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTGCCAACCTCCTCATTCTAAGTG -3'
(R):5'- CTCATGGTCAAGCACCTGTG -3'

Sequencing Primer
(F):5'- AACCTCCTCATTCTAAGTGACTGGAG -3'
(R):5'- TGATCCCTGGAACCAATATGG -3'
Posted On2020-06-30