Incidental Mutation 'R8145:Pdzd2'
ID 632778
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Gm21706, A930022H17Rik, Pdzk3, 4930537L06Rik, LOC223364
MMRRC Submission 067573-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8145 (G1)
Quality Score 178.009
Status Validated
Chromosome 15
Chromosomal Location 12359797-12740010 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12407458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 334 (H334R)
Ref Sequence ENSEMBL: ENSMUSP00000140682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000190929]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000075317
AA Change: H560R

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: H560R

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190929
AA Change: H334R

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197
AA Change: H334R

DomainStartEndE-ValueType
PDZ 168 245 3e-20 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg6 A T 4: 99,634,564 (GRCm39) D273V probably damaging Het
Ankk1 T A 9: 49,327,097 (GRCm39) H694L possibly damaging Het
Asb7 G T 7: 66,309,696 (GRCm39) N173K probably benign Het
Atp10b A T 11: 43,092,949 (GRCm39) Q428L probably damaging Het
Bag3 A G 7: 128,147,612 (GRCm39) E409G possibly damaging Het
Bltp1 T C 3: 37,052,416 (GRCm39) S3039P probably damaging Het
Bpifb2 T A 2: 153,733,232 (GRCm39) V398E probably damaging Het
Btf3l4b A T 13: 96,217,649 (GRCm39) D63E probably benign Het
Ccr6 T C 17: 8,474,945 (GRCm39) V50A probably benign Het
Cdcp3 G T 7: 130,898,045 (GRCm39) V2088L unknown Het
Cdx1 T C 18: 61,152,995 (GRCm39) N204D probably damaging Het
Ciao1 T C 2: 127,087,726 (GRCm39) D203G possibly damaging Het
Cldn7 A T 11: 69,856,892 (GRCm39) Y47F possibly damaging Het
Col6a1 A T 10: 76,559,305 (GRCm39) D110E possibly damaging Het
Cpne6 C A 14: 55,752,025 (GRCm39) Q261K probably benign Het
Crebbp T C 16: 3,946,389 (GRCm39) T497A probably benign Het
Cyp2s1 A G 7: 25,507,467 (GRCm39) probably null Het
Ddx42 A T 11: 106,130,887 (GRCm39) I454F possibly damaging Het
Ddx5 G T 11: 106,672,911 (GRCm39) A538E probably benign Het
Dnajb1 T A 8: 84,336,944 (GRCm39) V238D probably damaging Het
Dntt A G 19: 41,044,224 (GRCm39) Y463C probably damaging Het
Eif4b A G 15: 102,001,423 (GRCm39) T437A unknown Het
Eppk1 T C 15: 75,990,900 (GRCm39) T1994A possibly damaging Het
Fbxw15 A T 9: 109,384,658 (GRCm39) C381S probably benign Het
Fosl2 T A 5: 32,310,412 (GRCm39) V287D probably damaging Het
Gdpd4 A G 7: 97,690,077 (GRCm39) T590A probably benign Het
Gm49368 A G 7: 127,712,487 (GRCm39) E877G probably null Het
Grin2b C T 6: 135,709,497 (GRCm39) A1350T probably benign Het
Gzmk A G 13: 113,308,430 (GRCm39) L257P probably damaging Het
Has2 T A 15: 56,545,175 (GRCm39) K142N probably benign Het
Hectd1 T C 12: 51,831,016 (GRCm39) E944G possibly damaging Het
Hmcn1 T C 1: 150,629,411 (GRCm39) R949G probably benign Het
Hmcn2 A G 2: 31,313,117 (GRCm39) E3442G probably damaging Het
Irf9 T A 14: 55,843,255 (GRCm39) C152* probably null Het
Itga3 A G 11: 94,943,290 (GRCm39) W936R probably damaging Het
Klhl11 G T 11: 100,354,740 (GRCm39) D360E probably damaging Het
Lnx1 G A 5: 74,846,060 (GRCm39) T130I probably benign Het
Lrrc36 C T 8: 106,170,396 (GRCm39) P82L probably damaging Het
Map4k4 T C 1: 40,039,694 (GRCm39) C29R Het
Mki67 T C 7: 135,296,065 (GRCm39) K2990E probably benign Het
Mnt G A 11: 74,733,799 (GRCm39) A477T unknown Het
Mroh9 A G 1: 162,890,096 (GRCm39) S214P probably benign Het
Mrps18b C A 17: 36,225,293 (GRCm39) R94L possibly damaging Het
Myh6 T A 14: 55,191,382 (GRCm39) I820F probably benign Het
Nphp3 A G 9: 103,913,050 (GRCm39) T943A probably benign Het
Or51a25 C A 7: 102,372,937 (GRCm39) L253F probably damaging Het
Or52b4i A G 7: 102,191,830 (GRCm39) H229R probably benign Het
Papolb T C 5: 142,514,353 (GRCm39) D430G probably benign Het
Pkd1l2 T A 8: 117,781,742 (GRCm39) M768L probably benign Het
Pklr G T 3: 89,052,795 (GRCm39) R547L probably benign Het
Pla2g4a T C 1: 149,716,394 (GRCm39) Y697C probably benign Het
Prkcd T C 14: 30,324,019 (GRCm39) T435A probably benign Het
Rfx1 C T 8: 84,800,657 (GRCm39) P86L probably benign Het
Rnf19b C A 4: 128,977,862 (GRCm39) A693D probably benign Het
Scn9a A G 2: 66,317,754 (GRCm39) I1578T probably damaging Het
Slamf9 A G 1: 172,303,942 (GRCm39) S96G probably benign Het
Slc17a8 T C 10: 89,412,233 (GRCm39) D584G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc2a7 C A 4: 150,252,818 (GRCm39) T486K probably damaging Het
Slc6a20a G A 9: 123,466,065 (GRCm39) A592V probably damaging Het
Spz1 T C 13: 92,711,609 (GRCm39) D289G probably benign Het
Sspo G A 6: 48,444,683 (GRCm39) C2226Y possibly damaging Het
Taf4b T G 18: 14,963,085 (GRCm39) D608E probably damaging Het
Tagap1 A T 17: 7,223,526 (GRCm39) I390N probably damaging Het
Tcp11l2 A G 10: 84,444,480 (GRCm39) N430D probably damaging Het
Thsd7b T C 1: 129,688,036 (GRCm39) L649P probably damaging Het
Tmprss15 C T 16: 78,757,473 (GRCm39) G956R probably damaging Het
Tnc G T 4: 63,935,716 (GRCm39) Q407K probably benign Het
Tti1 C A 2: 157,849,509 (GRCm39) E577* probably null Het
Vmn2r79 A T 7: 86,686,862 (GRCm39) M748L probably benign Het
Zbtb37 C T 1: 160,847,654 (GRCm39) R451Q probably damaging Het
Zfp1002 T C 2: 150,096,455 (GRCm39) K325E probably benign Het
Zfp566 A T 7: 29,777,785 (GRCm39) I132N probably benign Het
Zik1 C T 7: 10,223,930 (GRCm39) G389E probably damaging Het
Zzef1 A T 11: 72,799,295 (GRCm39) K2382* probably null Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12,458,069 (GRCm39) missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12,365,853 (GRCm39) splice site probably null
IGL00697:Pdzd2 APN 15 12,373,733 (GRCm39) missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12,374,498 (GRCm39) missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12,374,804 (GRCm39) missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12,402,718 (GRCm39) unclassified probably benign
IGL01389:Pdzd2 APN 15 12,374,712 (GRCm39) missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12,458,293 (GRCm39) missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12,445,750 (GRCm39) missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12,592,569 (GRCm39) missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12,372,632 (GRCm39) missense probably benign
IGL01915:Pdzd2 APN 15 12,371,725 (GRCm39) missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12,592,440 (GRCm39) missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12,376,382 (GRCm39) missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12,445,735 (GRCm39) missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12,375,851 (GRCm39) missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12,411,105 (GRCm39) missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12,385,720 (GRCm39) missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12,592,329 (GRCm39) missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12,376,113 (GRCm39) missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12,374,427 (GRCm39) missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12,382,708 (GRCm39) missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12,385,351 (GRCm39) missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12,388,628 (GRCm39) critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12,373,850 (GRCm39) missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12,399,374 (GRCm39) missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12,371,691 (GRCm39) missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12,368,027 (GRCm39) missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12,375,110 (GRCm39) missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12,592,246 (GRCm39) missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12,592,364 (GRCm39) missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12,376,385 (GRCm39) missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12,458,144 (GRCm39) missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12,399,356 (GRCm39) missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12,374,594 (GRCm39) missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12,371,725 (GRCm39) missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12,390,052 (GRCm39) critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12,373,173 (GRCm39) missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12,457,981 (GRCm39) missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12,458,306 (GRCm39) missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12,385,525 (GRCm39) missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12,411,108 (GRCm39) missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12,373,915 (GRCm39) missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12,373,047 (GRCm39) missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12,385,950 (GRCm39) missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12,592,546 (GRCm39) missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12,387,740 (GRCm39) missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12,390,134 (GRCm39) missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12,373,941 (GRCm39) missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12,457,972 (GRCm39) missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12,373,986 (GRCm39) missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12,385,905 (GRCm39) missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12,373,676 (GRCm39) missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12,406,645 (GRCm39) missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12,375,879 (GRCm39) missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12,373,934 (GRCm39) missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12,373,247 (GRCm39) missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12,375,557 (GRCm39) missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12,376,262 (GRCm39) missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12,375,594 (GRCm39) missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12,387,732 (GRCm39) missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12,376,061 (GRCm39) missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12,419,567 (GRCm39) missense possibly damaging 0.48
R4492:Pdzd2 UTSW 15 12,385,723 (GRCm39) missense possibly damaging 0.75
R4656:Pdzd2 UTSW 15 12,385,797 (GRCm39) missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12,419,602 (GRCm39) missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12,374,681 (GRCm39) missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12,385,429 (GRCm39) missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12,375,734 (GRCm39) missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12,592,494 (GRCm39) nonsense probably null
R5174:Pdzd2 UTSW 15 12,372,600 (GRCm39) missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12,390,119 (GRCm39) missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12,373,028 (GRCm39) missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12,592,263 (GRCm39) missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12,382,762 (GRCm39) missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12,374,367 (GRCm39) missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12,592,436 (GRCm39) nonsense probably null
R5704:Pdzd2 UTSW 15 12,385,761 (GRCm39) missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12,442,675 (GRCm39) missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12,592,656 (GRCm39) splice site probably null
R6222:Pdzd2 UTSW 15 12,374,652 (GRCm39) missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12,458,274 (GRCm39) missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12,592,551 (GRCm39) missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12,385,951 (GRCm39) missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12,374,123 (GRCm39) missense probably benign
R6955:Pdzd2 UTSW 15 12,401,550 (GRCm39) missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12,375,993 (GRCm39) missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12,457,945 (GRCm39) missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12,373,061 (GRCm39) missense probably benign 0.14
R7014:Pdzd2 UTSW 15 12,372,647 (GRCm39) missense probably benign 0.13
R7110:Pdzd2 UTSW 15 12,368,099 (GRCm39) missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12,376,209 (GRCm39) missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12,458,231 (GRCm39) nonsense probably null
R7228:Pdzd2 UTSW 15 12,373,059 (GRCm39) missense probably benign 0.01
R7317:Pdzd2 UTSW 15 12,592,329 (GRCm39) missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12,437,248 (GRCm39) missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12,399,291 (GRCm39) missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12,372,820 (GRCm39) missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12,373,289 (GRCm39) missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12,407,422 (GRCm39) missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12,373,460 (GRCm39) missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12,374,102 (GRCm39) missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12,385,872 (GRCm39) missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12,373,122 (GRCm39) missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12,373,122 (GRCm39) missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12,373,592 (GRCm39) missense probably benign 0.01
R8220:Pdzd2 UTSW 15 12,592,249 (GRCm39) missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12,375,995 (GRCm39) missense probably benign
R8768:Pdzd2 UTSW 15 12,437,252 (GRCm39) missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12,402,405 (GRCm39) missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12,375,612 (GRCm39) missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12,374,385 (GRCm39) missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12,374,753 (GRCm39) missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12,374,342 (GRCm39) missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12,386,023 (GRCm39) missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12,375,114 (GRCm39) missense
R9515:Pdzd2 UTSW 15 12,374,621 (GRCm39) missense probably damaging 1.00
R9592:Pdzd2 UTSW 15 12,458,106 (GRCm39) missense probably damaging 1.00
R9614:Pdzd2 UTSW 15 12,375,486 (GRCm39) missense probably damaging 1.00
R9630:Pdzd2 UTSW 15 12,374,443 (GRCm39) missense probably benign 0.37
R9776:Pdzd2 UTSW 15 12,457,909 (GRCm39) missense probably benign 0.03
X0057:Pdzd2 UTSW 15 12,411,113 (GRCm39) missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12,368,805 (GRCm39) missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12,372,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAATATGCTGCCACTCTCG -3'
(R):5'- TAAGCAGCTCTCTGTGACGG -3'

Sequencing Primer
(F):5'- CACTCTCGTGGAGGGCAAAAG -3'
(R):5'- GGGAGACTCTGCTCCATGTAG -3'
Posted On 2020-06-30