Incidental Mutation 'R8145:Tagap1'
ID632784
Institutional Source Beutler Lab
Gene Symbol Tagap1
Ensembl Gene ENSMUSG00000052031
Gene NameT cell activation GTPase activating protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8145 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location6955011-6961156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6956127 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 390 (I390N)
Ref Sequence ENSEMBL: ENSMUSP00000070466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063683]
Predicted Effect probably damaging
Transcript: ENSMUST00000063683
AA Change: I390N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070466
Gene: ENSMUSG00000052031
AA Change: I390N

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,267 S3039P probably damaging Het
5430419D17Rik G T 7: 131,296,316 V2088L unknown Het
Alg6 A T 4: 99,746,327 D273V probably damaging Het
Ankk1 T A 9: 49,415,797 H694L possibly damaging Het
Asb7 G T 7: 66,659,948 N173K probably benign Het
Atp10b A T 11: 43,202,122 Q428L probably damaging Het
Bag3 A G 7: 128,545,888 E409G possibly damaging Het
Bpifb2 T A 2: 153,891,312 V398E probably damaging Het
Ccr6 T C 17: 8,256,113 V50A probably benign Het
Cdx1 T C 18: 61,019,923 N204D probably damaging Het
Ciao1 T C 2: 127,245,806 D203G possibly damaging Het
Cldn7 A T 11: 69,966,066 Y47F possibly damaging Het
Col6a1 A T 10: 76,723,471 D110E possibly damaging Het
Cpne6 C A 14: 55,514,568 Q261K probably benign Het
Crebbp T C 16: 4,128,525 T497A probably benign Het
Cyp2s1 A G 7: 25,808,042 probably null Het
Ddx42 A T 11: 106,240,061 I454F possibly damaging Het
Ddx5 G T 11: 106,782,085 A538E probably benign Het
Dnajb1 T A 8: 83,610,315 V238D probably damaging Het
Dntt A G 19: 41,055,785 Y463C probably damaging Het
Eif4b A G 15: 102,092,988 T437A unknown Het
Eppk1 T C 15: 76,106,700 T1994A possibly damaging Het
Fbxw15 A T 9: 109,555,590 C381S probably benign Het
Fosl2 T A 5: 32,153,068 V287D probably damaging Het
Gdpd4 A G 7: 98,040,870 T590A probably benign Het
Gm20075 A T 13: 96,081,141 D63E probably benign Het
Gm21994 T C 2: 150,254,535 K325E probably benign Het
Gm49368 A G 7: 128,113,315 E877G probably null Het
Grin2b C T 6: 135,732,499 A1350T probably benign Het
Gzmk A G 13: 113,171,896 L257P probably damaging Het
Has2 T A 15: 56,681,779 K142N probably benign Het
Hectd1 T C 12: 51,784,233 E944G possibly damaging Het
Hmcn1 T C 1: 150,753,660 R949G probably benign Het
Hmcn2 A G 2: 31,423,105 E3442G probably damaging Het
Irf9 T A 14: 55,605,798 C152* probably null Het
Itga3 A G 11: 95,052,464 W936R probably damaging Het
Klhl11 G T 11: 100,463,914 D360E probably damaging Het
Lnx1 G A 5: 74,685,399 T130I probably benign Het
Lrrc36 C T 8: 105,443,764 P82L probably damaging Het
Map4k4 T C 1: 40,000,534 C29R Het
Mki67 T C 7: 135,694,336 K2990E probably benign Het
Mnt G A 11: 74,842,973 A477T unknown Het
Mroh9 A G 1: 163,062,527 S214P probably benign Het
Mrps18b C A 17: 35,914,401 R94L possibly damaging Het
Myh6 T A 14: 54,953,925 I820F probably benign Het
Nphp3 A G 9: 104,035,851 T943A probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr559 C A 7: 102,723,730 L253F probably damaging Het
Papolb T C 5: 142,528,598 D430G probably benign Het
Pdzd2 T C 15: 12,407,372 H334R probably benign Het
Pkd1l2 T A 8: 117,055,003 M768L probably benign Het
Pklr G T 3: 89,145,488 R547L probably benign Het
Pla2g4a T C 1: 149,840,643 Y697C probably benign Het
Prkcd T C 14: 30,602,062 T435A probably benign Het
Rfx1 C T 8: 84,074,028 P86L probably benign Het
Rnf19b C A 4: 129,084,069 A693D probably benign Het
Scn9a A G 2: 66,487,410 I1578T probably damaging Het
Slamf9 A G 1: 172,476,375 S96G probably benign Het
Slc17a8 T C 10: 89,576,371 D584G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc2a7 C A 4: 150,168,361 T486K probably damaging Het
Slc6a20a G A 9: 123,637,000 A592V probably damaging Het
Spz1 T C 13: 92,575,101 D289G probably benign Het
Sspo G A 6: 48,467,749 C2226Y possibly damaging Het
Taf4b T G 18: 14,830,028 D608E probably damaging Het
Tcp11l2 A G 10: 84,608,616 N430D probably damaging Het
Thsd7b T C 1: 129,760,299 L649P probably damaging Het
Tmprss15 C T 16: 78,960,585 G956R probably damaging Het
Tnc G T 4: 64,017,479 Q407K probably benign Het
Tti1 C A 2: 158,007,589 E577* probably null Het
Vmn2r79 A T 7: 87,037,654 M748L probably benign Het
Zbtb37 C T 1: 161,020,084 R451Q probably damaging Het
Zfp566 A T 7: 30,078,360 I132N probably benign Het
Zik1 C T 7: 10,490,003 G389E probably damaging Het
Zzef1 A T 11: 72,908,469 K2382* probably null Het
Other mutations in Tagap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Tagap1 APN 17 6956883 missense probably benign 0.00
IGL02138:Tagap1 APN 17 6956086 missense probably damaging 1.00
IGL02475:Tagap1 APN 17 6956427 missense probably benign 0.41
IGL02955:Tagap1 APN 17 6956382 missense probably damaging 1.00
R1494:Tagap1 UTSW 17 6956811 missense probably damaging 1.00
R1824:Tagap1 UTSW 17 6956026 missense probably benign 0.02
R1990:Tagap1 UTSW 17 6956886 missense probably benign 0.00
R2067:Tagap1 UTSW 17 6956860 missense probably benign 0.00
R2086:Tagap1 UTSW 17 6956703 missense probably benign 0.00
R2111:Tagap1 UTSW 17 6956860 missense probably benign 0.00
R4425:Tagap1 UTSW 17 6956112 missense probably benign 0.00
R5271:Tagap1 UTSW 17 6956096 nonsense probably null
R5728:Tagap1 UTSW 17 6957021 missense probably benign 0.30
R7100:Tagap1 UTSW 17 6956712 missense possibly damaging 0.83
Z1177:Tagap1 UTSW 17 6956617 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGCTCAGTCACAGAAG -3'
(R):5'- AGCATTGGGTCTGAGAAATCC -3'

Sequencing Primer
(F):5'- GTGCTCAGTCACAGAAGACAATC -3'
(R):5'- GGGTCTGAGAAATCCAAAGACTTTTC -3'
Posted On2020-06-30